Конверт звездочка для новорожденных выкройка: Конверт для новорожденного своими руками из флиса для сна

Содержание

Вязаные конверты для новорожденных в Харькове

645 ₴

Зимний, вязаный конверт-плед Мишутка для новорожденного +380 (97) 16… показать

из Днепра в Харьков

Купить

645 ₴

Зимний, вязаный конверт-плед Мишутка молочный для новорожденного +380 (97) 16… показать

из Днепра в Харьков

Купить

645 ₴

Зимний, вязаный конверт-плед Мишутка коричневый для новорожденного +380 (97) 16… показать

из Днепра в Харьков

Купить

444,17 ₴

Конверт для новорожденных 4 сезона Вязаный +380 (66) 70… показать

по г. Харьков

Купить

494,26 ₴

Вязанный конверт для новорожденных +380 (66) 70… показать

по г. Харьков

Купить

494,26 ₴

Вязанный конверт на выписку для новорожденных +380 (66) 70… показать

по г. Харьков

Купить

570 ₴

Вязаный конверт-плед для новорожденных весна-осень 100х80 см +380 (97) 44… показать

из Киевской области в Харьков

Купить

-67%

199,98 ₴ 600 ₴

Демисезонный вязанный конверт для новорожденного в коляску цвета кофе +380 (67) 32… показать

из Киева в Харьков

Купить

-67%

199,98 ₴ 600 ₴

Демисезонный вязанный конверт для новорожденного в коляску бежевого цвета +380 (67) 32… показать

из Киева в Харьков

Купить

-67%

199,98 ₴ 600 ₴

Демисезонный вязанный конверт для новорожденного в коляску розового цвета +380 (67) 32… показать

из Киева в Харьков

Купить

1 240 ₴

Демисезонный вязаный конверт «Familia» для новорожденных малышей (85х85 см) ТМ MagBaby Капучино +380 (68) 53… показать

из Киева в Харьков

Купить

725 ₴

Летний вязанный конверт-плед с кисточкой для новорожденных на выписку ТМ MagBaby 5 цветов +380 (68) 53… показать

из Киева в Харьков

Купить

1 240 ₴

Вязаный демисезонный конверт «Familia» для новорожденных на выписку из роддома (85х85 см) ТМ MagBaby Хаки +380 (68) 53… показать

из Киева в Харьков

Купить

645 ₴

Зимний, вязаный конверт-плед Мишутка для новорожденного +380 (97) 16… показать

из Днепра в Харьков

Купить

645 ₴

Зимний, вязаный конверт-плед Мишутка розовый для новорожденного +380 (97) 16… показать

из Днепра в Харьков

Купить

1 340 ₴

Зимний, вязаный конверт-плед и человечек Мишутка для новорожденного +380 (97) 16… показать

из Днепра в Харьков

Купить

-67%

199,98 ₴ 600 ₴

Демисезонный вязанный конверт для новорожденного в коляску серого цвета +380 (67) 32… показать

из Киева в Харьков

Купить

725 ₴

Летний вязанный конверт-плед с кисточкой для новорожденных на выписку ТМ MagBaby 5 цветов Серый +380 (68) 53… показать

из Киева в Харьков

Купить

725 ₴

Летний вязанный конверт-плед с кисточкой для новорожденных на выписку ТМ MagBaby 5 цветов Коричневый +380 (68) 53… показать

из Киева в Харьков

Купить

1 240 ₴

Вязаный конверт «Familia» на весну-осень для новорожденных малышей (85х85 см) ТМ MagBaby Бежевый +380 (68) 53… показать

из Киева в Харьков

Купить

1 240 ₴

Вязаный конверт «Familia» весенне-осенний для новорожденных малышей (85х85 см) ТМ MagBaby Серый +380 (68) 53… показать

из Киева в Харьков

Купить

1 240 ₴

Вязаный весенне-осенний конверт «Familia» для новорожденных малышей (85х85 см) ТМ MagBaby Горчица +380 (68) 53… показать

из Киева в Харьков

Купить

865 ₴

Вязаный демисезонный конверт-одеяло для новорожденного «Косы» 85*85 см ТМ MagBaby Бежевый +380 (68) 53… показать

из Киева в Харьков

Купить

865 ₴

Детский вязаный демисезонный конверт-одеяло для новорожденного «Косы» 85*85 см ТМ MagBaby Капучино +380 (68) 53… показать

из Киева в Харьков

Купить

865 ₴

Вязаный демисезонный конверт-одеяло «Косы» для новорожденного 85*85 см ТМ MagBaby Молочный +380 (68) 53… показать

из Киева в Харьков

Купить

865 ₴

Вязаный весенне-осенний конверт-одеяло для новорожденного «Косы» р. 85*85 см ТМ MagBaby Серый +380 (68) 53… показать

из Киева в Харьков

Купить

865 ₴

Вязаный детский весенне-осенний конверт-одеяло «Косы» для новорожденного (р. 85*85 см) ТМ MagBaby Хаки +380 (68) 53… показать

из Киева в Харьков

Купить

632 ₴

Демисезонный вязанный плед-конверт для новорожденного малыша р. 90*90 см ТМ Модный Карапуз Белый +380 (68) 53… показать

из Киева в Харьков

Купить

632 ₴

Вязаный плед-конверт на весну-осень для новорожденного мальчика р. 90*90 см ТМ Модный Карапуз Голубой +380 (68) 53… показать

из Киева в Харьков

Купить

725 ₴

Под заказ

Летний вязанный конверт-плед с кисточкой для новорожденных на выписку ТМ MagBaby 5 цветов Молочный +380 (68) 53… показать

из Киева в Харьков

Купить

725 ₴

Под заказ

Летний вязанный конверт-плед с кисточкой для новорожденных на выписку ТМ MagBaby 5 цветов Голубой +380 (68) 53… показать

из Киева в Харьков

Купить

Как связать конверт для новорожденного крючком

Вязание конверта для новорожденных крючком

4 минуты Автор: Анастасия Егорова 1817

Тепленький вязаный конверт для новорожденного будет отличным подарком молодым родителям. А если вещь будет изготовлена с любовью своими руками, то это вдвойне приятней. Отличные вязаные вещи для малышей получаются при работе с крючком. Сегодня в интернете и журналах по вязанию можно найти прекрасные идеи, схемы и описания детских конвертов. Любая мамочка может попробовать сама связать конвертик своему ребенку и не придется покупать дорогую и не всегда качественную вещь в магазине.

Вязаный конверт «Моя звездочка»

Такое изделие, выполненное крючком, станет отличной альтернативной покупному конвертику.

Примечание: Если использовать флисовую подкладку, хорошо удерживающую тепло, и толстую шерстяную пряжу, то «звездочку» можно использовать в качестве полноценного демисезонного конверта.

Исходные материалы

Пряжа (лучше взять желтую, но можно использовать любой другой цвет) – 3 мотка.

  • Крючок вязальный №5.
  • Небольшие пуговички – 3 шт.

Описание работы

▪ Сначала нужно связать основу будущей передней и задней части изделия. В качестве основы выступает пятиугольник. Их понадобится 2 шт. Вязание происходит по следующему описанию:

Сначала вяжется одна деталь, затем, вместе с пряжей откладывается и вяжется другая из второго мотка.
2. Теперь нужно связать «лучи» звездочки. Они вяжутся каждый отдельно. Описание используется следующее:

Остальные лучи вяжутся аналогично.
Потребуется связать все пять «лучей» для спинки и три для переда («лучи» для одной ручки и ножек).

▪ Один из рукавов конверта вначале вяжется чуть иначе, чем остальные «лучи», так как необходимо оформить горловину изделия.
После этого рукавчик вяжется до конца, как остальные «лучи» звездочки.

▪ Теперь нужно связать капюшон, чтобы конверт для новорожденного получился не только красивый, но и теплый.

▪ Сборка деталей изделия. Уголок капюшона и рукав нужно пришить к задней части конверта. После этого, необходимо сшить переднюю и заднюю части изделия. Сшивать лучше теми же нитками, которыми выполнялось вязание. Так швы будут совсем незаметны.

В завершение нужно пришить пуговички для застежки. Петельки для пуговиц можно сделать отдельно, а можно использовать элементы рисунка в качестве петель.

Конверт-мешок крючком

Для прогулок в коляске удобнее всего использовать связанный крючком конверт-мешок. Также такая модель детского спальника отлично выручит дома, если температура в помещении слишком низкая для маленького ребенка.

Примечание: Размер изделия в мастер-классе подойдет для крохи от рождения до 3-х месяцев. Если конвертик требуется для малыша до года (размер 74─86), то следует использовать данные, которые указаны в скобках.

Исходные материалы

  • Пряжа для основного вязания (бежевая) – 400 г. (450 г.).
  • Пряжа для отделки (темно-фиолетовая) – 100 г.
  • Застежки «кнопки» – 5 шт. Лучше выбирать кнопки крупного размера.
  • Крючок вязальный №4, 5 для основного вязания.
  • Крючок вязальный №5 для отделки.

Схемы и выкройка

Совет: Лучше всего перенести выкройку на бумагу, выполнив ее в натуральную величину. Так по ходу работы, выполняя прибавки и убавки, можно будет прикладывать вязание к выкройке, и сверяться, чтобы все было правильно.

Плотность вязания

Основной узор: 15, 5 п. на 7, 5 р. = 10х10 см.
Столбики без накида: 15 п на 7, 5 р. = 10х10 см.

Описание работы

1. Вязание деталей

Все детали конвертика вяжутся отдельно. Обязательно используются выкройки для каждой части изделия. Для более подробного ознакомления с ходом работы можно воспользоваться данным описанием:

2. Сборка

Перед тем как сшивать отдельные детали конверта, их необходимо хорошо отпарить и высушить, предварительно наколов булавками на выкройки, чтобы они приняли нужную форму. После высыхания можно начинать сборку конверта.

Сначала выполняются плечевые швы, затем аккуратно пришивается капюшон. Швы лучше всего делать нитками, которыми вязалось изделие.
Края полочек и капюшона нужно обвязать столбиками без накида фиолетовыми нитками. При желании капюшон можно декорировать кисточкой.

После этого выполняются боковые швы. При сшивании низа изделия нужно сделать так, чтобы планка правой полочки немного заходила на планку левой полочки – это необходимо для застежки.

В конце пришиваются кнопки застежки. Готовое изделие чуть отпаривается утюгом. Стильный конверт для новорожденного готов!

Взяв на вооружение идеи из статьи, можно связать потрясающую вещь для своего малыша. А если подключить фантазию, использовать различные схемы рисунков и яркую пряжу, совершенно точно получится эксклюзивное и модное изделие. Как связать конверт для ребенка спицами можно узнать в этой статье.


Как связать конверт для новорожденного крючком

Плотность вязания (читать далее…)

Перед тем как сшивать отдельные детали конверта, их необходимо хорошо отпарить и высушить, предварительно наколов булавками на выкройки, чтобы они приняли нужную форму. После высыхания можно начинать сборку конверта.

Вязание конверта для новорожденных крючком
Тепленький вязаный конверт для новорожденного будет отличным подарком молодым родителям. А если вещь будет изготовлена с любовью своими руками, то это вдвойне приятней. Отличные вязаные вещи для малышей получаются при работе с крючком. Сегодня в интернете и журналах по вязанию можно найти прекрасные идеи, схемы и описания детских конвертов. Любая мамочка может попробовать сама связать конвертик своему ребенку и не придется покупать дорогую и не всегда качественную вещь в магазине. Как связать конверт для новорожденного крючком

Вязаный спицами конверт для новорожденного – работа Марии Гнедько (читать далее…)

Праздничный кокон на выписку, как правило, дополнительно украшают аксессуарами: лентами, кружевом. Повседневный вязаный конверт чуть более демократичен в исполнении. Зимний конверт стоит вязать с небольшим запасом, чтобы можно было надеть на малыша теплую одежду, но и слишком свободный будет приносить дискомфорт. Стандартный размер конверта – 42/75 см.

Как связать спицами теплые и практичные конверты для новорожденных

  1. Практичность – в состав пряжи для детского конверта должны входить в зависимости от сезона бамбук, премиум акрил, мериносовая шерсть экстрафайн, хлопок, беби-альпака, микрофибра.
  2. Функциональность (легкость в стирке и практичная носка). Конверт, связанный спицами, будет одинаково гармонично выглядеть в автолюльке, санках, коляске, на прогулке и дома. Конверт-трансформер, который можно впоследствии превратить в комбинезон или практичное одеяло, станет отличным дополнением гардероба нового члена семьи.
  3. Вязание для новорожденных и детей постарше должно выполняться без швов из пряжи высшего качества.

Как связать конверт для новорожденного крючком

Для девочки (читать далее…)

Для зимы идеальнее всего подойдет плотный детский конвертик, который будет хорошо удерживать тепло. При вывязывании изделия можно сочетать платочную вязку с ромбами. На лето можно связать ажурную модель. Изделие с косами пригодится в качестве ежедневного варианта. Конверты на выписку для новорожденных вязаные со схемой можно сделать по такому образцу.

Вязаные конверты новорожденным со схемой
Стандартные вязаные конверты для новорожденных на выписку имеют размер 42 x 75 см, но нужно учитывать рост и вес ребенка. Зимний конверт лучше вязать большего размера, с учетом того, что младенца придется носить в нем в теплой одежде и толстых носочках.

Комплекты с конвертом на выписку в Екатеринбурге

Итак, какие
виды комплектов на выписку существуют и в чем их отличия?

 1.      Сезон

  • летние
  • демисезонные
  • зимние

Комплекты
отличаются друг от друга теплотой наполнителя и одежды, плотностью ткани одеяла
или конверта.

 2.      Главный предмет комплекта 

  • конверт
  • одеяло
  • одеяло и
    конверт
  • только
    одежда

Конверт

  • Хотите красивые фото с выписки?
    Берите комплект с конвертом. Он даёт больше объема: есть, что подержать в
    руках. Запас по росту позволяет использовать его для прогулок до 3-4
    месяцев.
  • Уверенности придаёт матрасик-дно из
    ортофайбера. Не страшно взять младенца даже неопытному родственнику. Дно защищает
    спинку малыша от холода, если положить конверт на зимнюю скамейку.
  • Если малыш заснул на прогулке, прямо
    в конверте его можно переложить в кроватку, расстегнув, чтобы ребенок не
    вспотел.
  • Дополняющий капюшон с затяжными лямками надежно защищает головку от ветра и холода.

Одеялко

  • Привыкли управляться с пеленанием? Любите ленты-банты? Для вас комплекты с одеяльцами.
  • Летом это легкие акриловые пледы или
    текстильные тонкие одеяльца. Зимой — одеяла на меху или синтепон плотностью 300
    единиц.

 Комплекты с конвертом и с
одеялом/пледом

  •  Подойдет
    тем, кто родился зимой или в межсезонье (осень-зима, зима-весна). Включают в себя дополнительное утепление, а также варианты на переменчивую погоду.

 Комплекты без конверта и без одеяла

  • Состоят
    только из крошечной одежды и пелёнок, могут включать в себя пододеяльник — на
    случай, если у вас уже есть детское одеяло.

3.      Размер

 Мы выпускаем комплекты в 3 размерах:

  • мини-сайз -
    размер 16  на рост 50-56 см.
  • стандартный
    — размер 18 на рост 56-62 см. (при выписке такая одежда может быть велика, есть
    запас на 2 месяца)
  • размер 20 на
    рост 62-68 см. (для крупных деток до 3-х месяцев). 

4.       Набор одежды

Комплекты различаются  перечнем одежды, который прикладывается к
конверту или одеялу.

Например:

— пелёнки (лёгкая и тёплая)

— ползунки

— распашонка

— шапочка (лёгкая или в паре с
тёплой)

— чепчик

— варежки-антицарапки

— комбинезон-слип или утеплённый велюровый
комбинезон

— одноразовый подгузник

— пеленка-уголок или нагрудник

Комплектация многообразна: может
включать в себя разный перечень и количество предметов одежды. Кроме того, в
зависимости от сезона материал может отличаться по плотности и теплоте.

5.      Цена

Стоимость зависит от наличия/отсутствия базового
предмета в наборе, количества одежды, материала ткани
(ситец/фланель/синтепон и т.д.), отделки.

Виды конвертов на выписку на зиму, лето, осень и весну? Как сшить конверт своими руками по выкройке?

Покупка или самостоятельное изготовление детской одежды и всевозможных аксессуаров доставляет маме огромное удовольствие. Переезд из родильного дома должен быть организован по всем правилам удобства и эстетики. В этом посте мы расскажем про то, как изготовить конверт для новорожденного на выписку своими руками или безошибочно выбрать его в магазине.

Что такое конверт на выписку?

Конверт для новорожденного — это важный атрибут для транспортировки ребенка из родильного дома в его новое жилище. Этим предметом можно пользоваться и дальше, некоторые модели-трансформеры пригодны к применению вместо одеяла и комбинезона с рождения до года.

Конверты для разных погодных условий, мальчиков и девочек, различаются дизайном и конструкцией. Ребенку тепло и спокойно, когда он находится внутри уютного гнездышка. Конвертик должен быть изготовлен из полностью гипоаллергенных материалов и ничем не угрожать малышу. Предмет обязателен к покупке, либо его нужно сшить самостоятельно. Этим занимаются перед появлением на свет ребенка, когда его пол и месяц рождения уже известны.

Существуют летние, зимние, демисезонные модели. С конвертом путешествие из роддома домой будет максимально эстетичным, можно сделать красивые фото и видео, приятно удивить папу и всех остальных родственников. Этот аксессуар может выглядеть как одеяло, иметь ручки.

Популярные товары из этой категории:

  • Muffy;
  • JustCute;
  • Choupette;
  • HitMama;
  • Мой ангелок;
  • Baby Nice;
  • Lappetti;
  • Сонный гномик;
  • Futurmama;
  • Карапуз;
  • Esspero;
  • Sdobina;
  • Bombus;
  • Kaiser;
  • Золотой гусь;
  • Pituso;
  • Argo Baby;
  • Chepe;
  • Папитто.

Виды конвертов на выписку

Конверт-трансформер

Детские конверты с возможностью трансформирования сегодня ультра-популярны, так как они реально лучше многих других моделей. Это действительно практичная, удобная и многофункциональная вещица, которая решает много проблем и долго служит для разных целей. Мамы в восторге от трансформеров, так как они выполняют роль верхней одежды, спасающей от суровых зимних холодов маленького ребенка. До года это конверт, а после года уже милый теплый комбинезон.

Преобладающее большинство моделей трансформеров имеют съемную подкладку, что очень удобно, так как можно пользоваться изделием в слегка прохладную и очень морозную погоду. Аксессуар имеет манжеты, застежку-молнию, клапан для регулировки воротника.


трансформер

Конверт-мешок

Детский спальный мешок используют с рождения. Он обеспечивает удобную выписку из родильного дома, а также приятные прогулки в коляске и санках. Бесспорным преимуществом мешочка выступает отсутствие лишних деталей и доступная цена. Конструкция предельно простая и никогда не подведет. Мама кладет ребенка в конверт и застегивает его на молнии и/или липучки.

По желанию можно приобрести зимний, летний и демисезонный мешок. Внешняя часть конверта — это непромокаемый чехол, поэтому ребенку всегда комфортно и сухо внутри. Единственный минус мешка заключается в том, что он подходит только самым маленьким, то есть детям сразу после рождения. Как мы знаем, они быстро растут, и вскоре в мешке становится мало места.


мешок

Конверт-одеяло

Как правило, под конвертом-одеялом подразумевается легкий тонкий аксессуар для ребенка. Одеяло сворачивается в конус, остается лишь уложить ребенка и закрепить его ленточкой, застежкой либо липучкой. В продаже можно встретить теплые одеяла для зимы.

Если вы отдали предпочтение такому аксессуару два в одном, то обязательно проверьте его в действии, посмотрите, нет ли отверстий в конструкции, когда она в сложенном виде. Главное, чтобы ребенку было не холодно. Также обращайте внимание на ткань. Все знают, что атласная отделка нарядна, но на деле она неудобна, так как конверт скользкий и его неудобно держать.


одеяло

Конверт для автомобиля

При выборе конверта для маленького обязательно учитывайте вопрос безопасного передвижения в автомобиле. На этот вопрос мало кто обращает внимание. Дело в том, что ребенка необходимо перевозить строго в специальном кресле, в которое войдет далеко не каждое одеяло для выписки. Этот вопрос принципиально продумать заранее, чтобы не пришлось везти малыша не по правилам, держа на руках. Если вам удастся найти подходящий конверт, то не возникнет сложностей с застегиванием ремней безопасности на детском кресле.


автомобильный конверт

Конверт с комбинезоном

Некоторым мамам больше всего нравится конверт-комбинезон. Он отличается от трансформера, но тоже предоставляет ребенку комфорт, тепло и свободу движений. Комбинезон разработан для развитых и очень подвижных малышей.

Некоторые дети имеют особый темперамент, они показывают недовольство всякий раз, когда их пытаются запеленать и ограничить свободу. Им идеально подходит комбинезон. Сверху вшиты удобные рукава, куда помещаются ручки, а снизу теплый мешок для нижней части тела. Получается, что это спальный мешок-конверт с рукавами. Самые удобные модели имеют очень широкий мешок, то есть нижняя часть просторная и позволяет ребенку двигаться как ему хочется.


комбинезон

Конверт-люлька

Кроме перечисленных моделей, бывают конверты с усиленным дном, где жесткая подложка держит спину ребенка. Детский аксессуар выглядит как люлька и имеет ручки для переноски ребенка разными способами. В таком конверте держать новорожденного ребенка удобно даже неопытному в этом деле человеку.

Люлька может являться самостоятельным аксессуаром или частью коляски, качалки а также представлять собой автомобильное кресло для новорожденных. Эти модели имеют внешний вид люльки, но в корне друг от друга отличаются.


люлька

Как выбрать изделие для новорожденного по времени года?

Зима

Самый теплый вариант — это зимний конверт. В нем ребенку должно быть очень уютно, независимо от того, какая погода снаружи. Утепленные конверты могут иметь разный наполнитель, например, бюджетный синтепон, дорогой пух гусей и уток, натуральную овчину и бамбуковое волокно. У каждого материала свои достоинства и недостатки, выбор на любителя, а также по финансовым возможностям.

Зимние конверты удобны еще и тем, что они состоят из деталей и можно стирать только внутреннюю часть с подкладкой, а наружную слегка чистить влажным способом. Обычно больше пачкается внутренность. Также зимой можно иметь одну наружную часть и купить несколько вариантов внутреннего конверта, использовать их в разную погоду. Чаще всего зимний конверт — выглядит как мешок.


зимний конверт

Лето

Летний конверт отличается особой легкостью. Обычно он изготовлен из дышащих материалов и имеет съемные утепляющие элементы. Подкладку можно убрать и присоединить при необходимости. Летом погода может быть разной, в зависимости от региона и особенностей климата. Ребенка летом не стоит перегревать.


летний конверт

Осень

Осенний конверт немного легче зимнего, но тоже должен защищать новорожденного от переохлаждения. Осенью может быть достаточно холодно, поэтому летняя одежда уже не актуальна. Конверты для листопадного времени года имеют застежку молнию, пуговицы или липучки. Должна быть надежная защита от ветра.


осенний конверт

Весна

Весенние конверты имеют позитивный дизайн и являются средне-теплыми. Весной еще рано одевать ребенка так, как летом, поэтому должна присутствовать плотная подкладка. Демисезонный конверт может выглядеть как мешок или одеяло-трансформер, главное, чтобы в нем не было слишком жарко или холодно.


весенний конверт

Из какого материала выбрать конверт?

Шерсть

Овечья шерсть — это природный терморегулирующий материал, при контакте с ним будет не жарко и не холодно. Благодаря такому наполнителю, исключается потение и температура внутри конверта стабильно теплая.

Овчина спасает в морозы, не вызывает аллергию, обладает лечебным свойством, впитывает запахи и влагу, восстанавливается после проветривания.


шерсть

Пух

Еще один хороший вариант наполнителя для конверта — это утиный и гусиный пух. Данный наполнитель отличается способностью к удержанию тепла, что немаловажно для грудничка.

Изделие легковесное и приятное, но имеет один значительный минус, поэтому не столь распространено у современных мам. Этот недостаток заключается в том, что наполнитель быстро комкуется, особенно от интенсивной эксплуатации и от частых стирок. Второй минус — это вероятность аллергии у детей на пух.


пух

Мех

Из меха животных может состоять подкладка, наполнитель либо только опушка конверта. Утепленный аксессуар можно использовать для прогулок в коляске и ребенку будет комфортно, как в шубке. Чаще всего меховой конверт выполнен в светлых тонах, выглядит как люлька или мешок на молнии.

Особенно удобны меховые конверты в форме комбинезонов. В продаже есть конверт-одеяло с меховой отделкой, совмещающий в себе две теплые вещи.


мех

Выбор конверта по полу

Для мальчика

Конверты для мальчиков не обязательно должны быть классического голубого цвета. Палитра огромная. В основном это оригинальные оттенки синего и голубого. Не возбраняется выбор бежевого или белоснежного цвета, он универсален и может быть впоследствии продан или подарен ребенку любого пола.

Мужской дизайн конвертов красив и разнообразен. Например, встречаются изделия с декором в виде пиджака или рубашки с галстуком или бабочкой. Мальчиковые одеяла украшают бантиками, ушками, милыми рисунками.


конверт для мальчика

Для девочки

Конверты для маленьких девочек имеют самый нежный дизайн. Обычно это мешки, комбинезоны или одеяла с бантами, оборками, кружевами. Девочке подойдет конверт любого оттенка розового цвета, белый, красный, нежно-персиковый тона. Рисунки на нем могут быть совершенно любые. Самые популярные — это принт в горошек, звездочки, мишки, котята, зайчики, цветы.


конверт для девочки

Универсальные варианты

Если неизвестен пол нового члена семьи, а конверт уже пора приобретать, то можно выбрать белый, бежевый, оранжевый, зеленый, многоцветный или любой пастельного тона конверт с нейтральным декором, который подойдет любому ребенку. Если точно известен пол ребенка, то можно купить именной конверт, это очень понравится родителям и близким.


универсальный конверт

Размеры конвертов

Размер детского конверта выбирается исходя из веса и роста ребенка, а также времени года. Параметры ребенка обычно уже известны во второй половине срока по УЗИ, врачи могут сказать, какой примерно он наберет вес и насколько вырастет к моменту рождения. Зимой потребуется максимально просторное изделие, так как ребенок будет одет в шапку, комбинезон и другую одежду, ему должно быть свободно.

Вопрос размеров важен, когда вы покупаете конверт-одеяло. Взгляните на габариты в разложенном виде, и вы поймете, удобно ли будет им пользоваться. Лучше всего купить конверт универсального среднего размера — это 75 на 42 см.

Как сшить конверт по выкройке?

Простая выкройка универсального конверта для самых маленьких приложена к этой статье. На фото показано, как выглядят детали, даны основные размеры. Для холодного времени года придется шить утепленный конверт, в остальных случаях он может быть легким. Изготовить конверт несложно, если мама обладает навыками кройки и шитья.


детали конверта


выкройка конверта


розовый конверт

Нужно вырезать из ткани детали и соединить их машинным швом. Также потребуется подкладка и утеплитель. Выберите подходящий способ крепления — клепки, пуговицы, шнурки, ленты. А также не забудьте про декор, это могут быть воланы по краю верхней части, вышивка на лицевой стороне, декоративные ушки, бантик.


схема конверта


самодельный конверт

Какой бы конверт вы не выбрали, он должен отлично согревать, быть красивым и сделан с душой. Выписка из родильного дома — счастливое и волнующее событие. Продумайте все заранее, чтобы этот праздник был особым и запомнился надолго всем членам семьи.

Конверт на выписку своими руками: пошаговые инструкции

Если в семье планируется прибавление, стоит сразу задуматься о том, в чём забирать ребёнка из роддома. Сегодня можно без проблем приобрести различные изделия. Если же среди них не найдётся подходящего варианта, можно сшить конверт на выписку новорождённого своими руками. Для этого, в зависимости от сезона, надо приобрести подходящие материалы и разобраться с технологией пошива.

Читайте в статье

Как выбрать конверт на выписку: полезные советы

Обычно вопросов о том, нужен ли конверт на выписку, не возникает. Красивый набор традиционно покупает каждая семья. Чтобы приобрести подходящее изделие, стоит учесть ряд параметров, среди которых наиболее важны следующие:

  • для кого приобретается комплект. От этого зависит цветовое и декоративное оформление. Для девочки берутся яркие модели с рюшами и бантиками. Для мальчиков менее красочные изделия в холодных тонах со сдержанным оформлением;
  • цель покупки. Если конверт будет использоваться только один раз в день выпуски, стоит выбрать нарядную модель. Для ежедневного пользования стоит заказать многофункциональный вариант;
  • материал, из которого пошито изделие. Независимо от состава, он должен быть безопасным для новорождённого;
  • сезон года. Для лета подойдёт изделие из хлопчатобумажной ткани с утеплителем из бамбука. Для зимы лучше выбрать модель с утепляющим слоем из альполюкса, тинсулейта, изософта. В качестве подкладки подойдёт флис.

ФОТО: cs2.livemaster.ruДля выписки из роддома подготавливают специальный конверт

Зимний вариант одеяла-конверта на выписку своими руками

В зимний период бывает достаточно холодно. Именно поэтому, решив пошить конверт-одеяло на выписку, стоит требовательно подойти к выбору материалов. Готовое изделие должно обеспечить комфортные условия малышу даже при низкой температуре.

ФОТО: static-eu.insales.ruЗимняя модель утепляется мехом

Материалы и инструменты

Для пошива одеяла надо иметь в наличии:

  • утеплитель с подходящими характеристика достаточной толщины. Чаще всего выбирают холофайбер либо синтепон;
  • ткань для наружного слоя. Это может быть шерсть, букле, плащёвка, твид, хлопчатобумажный деним;
  • материал для внутреннего слоя. Выбирают 30%-ную шерсть, позволяющую создать комфортные условия ребёнку во время прогулки;
  • молнию;
  • нитки подходящей расцветки;
  • шурок для затяжки.

ФОТО: static-eu.insales.ruВесь материал должен быть безопасен для ребёнка

Чтобы сшить конверт для новорождённого своими руками, надо иметь в наличии:

  • швейную машинку;
  • иголки;
  • ножницы;
  • английские булавки;
  • метр.

ФОТО: alispawprints.comДля работы потребуется стандартный набор швейного инструмента

Выкройка конверта для новорождённого: последовательность действий

Чтобы не продумывать все детали создания выкройки конверта для новорождённого, стоит воспользоваться уже готовыми.

ФОТО: img11.postila.ruГотовая выкройка конверта для новорождённого

ФОТО: i.pinimg.comФОТО: golova-idea.ruФОТО: umelieruchki.ru

Как сшить зимний конверт на выписку: подробная инструкция

Мастер-класс по пошиву конверта на выписку своими руками включает следующие этапы:

Демисезонный конверт-одеяло на выписку своими руками

Демисезонное одеяло-конверт для новорождённого шьют своими руками из различных тканей. Такое изделия должно обеспечить комфортные условия для малыша даже при значительных колебания температуры окружающего воздуха.

Материалы и инструменты

Для пошива одеяла-конверта на выписку своими руками берут плащёвку либо хлопок и плюш. Первый будет использоваться для изготовления наружного слоя, второй – внутреннего. Допустимо другое сочетание. В качестве утеплителя обычно берётся синтепон. Для обеспечения достаточного уровня тепловой защиты его используют в два слоя. Шьют конверт-одеяло на выписку обычно на швейной машинке. Кроме неё, надо иметь в наличии ножницы, булавки, метр.

ФОТО: static-eu.insales.ruЦвет плюша зависит от пола ребёнка и цвета наружного слоя

Выкройка

Чтобы сшить конверт на выписку своими руками, надо определиться с выкройкой модели и правильно раскроить материал. Здесь доступны различные варианты. Выбор делается в зависимости от того, как долго и как именно планируется пользоваться готовым изделием. Если оно предназначено не только на день выписки, но и на последующее ежедневное использование, стоит выбрать вариант одеяла-конверта

ФОТО: static-eu.insales.ruВыкройка для пошива конверта на выписку своими руками

Как сшить конверт-одеяло для новорождённого: подробная инструкция

Чтобы изделие получилось качественным, стоит детально разобраться с тем, как сшить конверт-одеяло на выписку. Действовать необходимо в следующей последовательности:

Иллюстрация Описание действия
Все детали отрезаются в размер. Плюш выкраивают чуть короче наружного слоя, так как он достаточно хорошо тянется. Хлопок соединяется с утеплителем и прострачивается на машинке с формированием клеток 22×22 см²
По контуру пристрачивают декоративную ленту. Пришивать начинают, отступив некоторое расстояние от края
Пришивают плюш. Для этого его лицевую сторону соединяют с лицевой стороной наружного слоя и пристрачивают по контуру, оставляя небольшой участок. Изделие выворачивается на лицевую сторону, а отверстие зашивается потайными стежками. Одеяло на выписку из роддома украшают своими руками с помощью банта либо другого декора

Предлагаем также посмотреть видео, в котором подробно рассказывается, как сшить конверт для новорождённого:

Мастер-класс по пошиву летнего конверта для новорождённого своими руками

Если вы решили сшить конверт для новорождённого своими руками, подробный мастер-класс поможет разобраться с тонкостями процесса. Все работы традиционно начинают с подготовки материалов и инструмента.

Материалы и инструменты

Чтобы пошить зимний или летний конверт на выписку своими руками, надо подготовить:

  • швейную машинку;
  • иголки;
  • ножницы;
  • английские булавки;
  • метр;
  • хлопок. Можно использовать хлопчатобумажную ткань одного цвета либо с разной расцветкой. Думая о том, как выбрать материал на летний конверт на выписку летом, следует помнить, что он должен создать комфортные условия;
  • декор;
  • синтепон. Учитывая, что своими руками будет шиться зимний конверт на выписку, утеплитель должен быть достаточной толщины.

ФОТО: static-eu.insales.ruРасцветка ткани выбирается с учётом пола

Выкройка

Выполнить раскрой поможет следующий мастер-класс:

Иллюстрация Описание действия
Из хлопка и синтепона вырезают два квадрата со стороной 100 см. Также вырезаются треугольники со стороной 40 см. Размер одеяла на выписку для новорождённого можно сделать меньше, например по 96 см
Закругляются края будущего одеяла-конверта. Для этого обводят тарелку диаметром около 20 см. Можно также воспользоваться шаблоном
Аналогичным образом формируется закругление на подготовленных треугольниках. Сначала обводится ткань, затем – синтепон

Пошив своими руками пледа для новорождённого

После подготовки всех элементов стоит разобраться, как сшить конверт на выписку. Действовать можно в следующей последовательности:

Иллюстрация Описание действия
В треугольном элементе две хлопковых детали укладываются друг на друга лицевой стороной внутрь и примётываются к синтепону с помощью английских булавок. После этого сшивается синтепон и ткань вдоль большой стороны, предварительно ослабив натяжение нити швейной машины
Хлопок выворачивается на лицевую сторону, разглаживается и прострачивается. Излишек синтепона отрезается
На ровной поверхности раскладывается слой синтепона, хлопка лицевой стороной вверх, треугольник и слой хлопка изнаночной стороной наружу. Элементы скрепляются между собой при помощи английских булавок. Если на выписку планируется сшить своими руками одеяло с ушками, их следует заложить между треугольником и основным элементом
Элементы сшиваются по периметру, оставляя небольшую часть для выворачивания на лицевую сторону
В углах, не доходя до шва, делаются небольшие надрезы, чтобы после выворачивания на лицевую сторону одеяло не сборило
Отверстие, через которое одеяло-конверт выворачивалось наружу, зашивают потайным стежком. Для фиксации элементов относительно друг друга изделие прострачивают по периметру. После этого плед для новорождённого, выполненный своими руками полностью готов

Способы крепления конверта-трансформера

Если решено сшить одеяло-трансформер для новорождённого своими руками, стоит сразу определиться с тем, каким способом будет производиться крепление. Выбор может быть сделан в пользу:

  • молнии. Самый быстрый и простой вариант. Однако всегда есть риск травмирования младенца об острые детали. Кроме того, в случае поломки замена будет трудоёмкой;
  • ленты. Такой конверт-трансформер для новорождённого выглядит красиво, но для его регулировки и фиксации потребуется время;
  • кнопок и пуговиц. Здесь твёрдые детали могут стать причиной травмы. Зато, при необходимости, их всегда можно быстро заменить.

Внимание! Выбирать механизм следует с учётом возраста и активности малыша.

ФОТО: i.pinimg.comМолния – самый быстрый способ

Варианты декора своими руками конверта на выписку из роддома

Чтобы изделие выглядело красиво и празднично, его обязательно украшают. Вариантов отделки достаточно много. Подходящий выбирают с учётом назначения конверта и пола ребёнка. Если одеялом планируется пользоваться ежедневно, стоит выбрать небольшое кружево, которое сохранит свой внешний вид после многочисленных стирок.

Предлагаем посмотреть видео, в котором рассказывается, как сделать бант для конверта на выписку своими руками:

Делитесь в комментариях, вы приобрели уже готовый конверт на выписку из роддома или предпочли сшить его своими руками.

ПОНРАВИЛАСЬ СТАТЬЯ? Поддержите нас и поделитесь с друзьями

Все для новорожденных своими руками, мастер-классы и видео

Если вы или ваши близкие ждут пополнения в семействе и вам хотелось бы сделать что-то уникальное для ребенка, то эта рубрика для вас. Тут собраны мастер-классы и видео по пошиву аксессуаров, игрушек и одежды для новорожденных.

Подпишитесь на меня ВКонтакте, если хотите узнать о других мастер-классах.

Конверт-кокон на выписку для новорожденных (выкройка)

, Ольга Максимова

За один или два вечера можно пошить такой конверт-кокон. Сделать это довольно просто. Убедитесь в этом сами, посмотрев данный мастер-класс.

Подушки для новорожденных Бабочка, Мишка и Сова (+ выкройки)

обновление от , Ольга Максимова

Мастер-класс по пошиву подушек для новорожденных в форме Бабочки, Мишки и Совы с выкройками.

Одеяло-трансформер/конверт на выписку для новорожденного

, Ольга Максимова

Ранее я шила несколько видов конвертов на выписку для новорожденных, а сегодня хочу показать, как можно сшить одеяло-трансформер своими руками. Такой конверт отлично подойдет для малышей от рождения и в первые месяцы жизни. Если расстегнуть молнии, то его можно использовать, как обычное одеялко, что существенно увеличит срок его службы.

Пеленка-кокон для новорожденных

, Ольга Максимова

Сейчас очень большой выбор различных предметов для новорожденных, облегчающих жизнь родителям.
Сегодня хочу показать, как своими руками сшить пленку-кокон для новорожденных. С ней запеленать ребенка легко и просто, ножки не сдавлены, ручки зафиксированы. Отличный вариант не только для домашнего использования или сна, но и похода на улицу или к врачу, так как сокращает время пеленания.

Органайзер на детскую кроватку/кармашки для мелочей

, Ольга Максимова

С появлением в доме малыша, появляются и множество различных мелочей для ухода за ним (это различные детские крема, присыпки, салфетки, соски и многое другое), которые нужно куда-нибудь складывать. В этом может помочь органайзер с множеством карманов. Он привязывается к кроватке с помощью лент, что очень удобно, так как все находится под рукой.

Корзина для хранения игрушек (+выкройка)

, Ольга Максимова

Поддерживать порядок в детской комнате помогают различные приспособления и аксессуары. Сегодня я покажу, как можно сшить текстильную корзину для хранения игрушек и других вещей. Такая корзина не только поможет навести порядок в комнате, но и будет украшением вашей детской.

Кокон-гнездышко для новорожденных (+ выкройка)

обновление от , Ольга Максимова

Продолжая тему мастер-классов для новорожденных, предлагаю сшить гнездышко-кокон. В такой кроватке малышу будет комфортнее спать и засыпать он будет лучше, так как чувствует рядом опору (в коконе теплее и уютнее). Также гнездышко-кокон можно брать с собой в путешествия и на природу, он будет играть роль кроватки.

Бант на выписку из роддома

, Ольга Максимова

Бант на выписку из роддома также можно сшить самим. В статье описано 2 мастер-класса: бант на выписку для мальчика и один из способов пошива банта на выписку для девочек.

Конверт на выписку для новорожденного своими руками (3 варианта)

обновление от , Ольга Максимова

Если вы хотите сами сшить конверт для новорожденного на выписку, то эта статья для вас. В этой статье описано 3 способа пошива конвертов для малышей: конверт-одеяло, теплый конверт и легкий мягкий плед-конверт на лето.

2 способа сшить слюнявчик своими руками (+выкройка)

, Ольга Максимова

Чтобы ваш ребёнок выглядел красиво за обеденным столом, можно сшить ему уникальный слюнявчик. Сегодня я покажу, как быстро и просто сшить слюнявчики в домашних условиях (2 способа + выкройка).

Зайка-комфортер / Игрушка-сплюшка для новорожденных

обновление от , Ольга Максимова

В этой статье я покажу мастер-класс по созданию популярной игрушки-комфортера (игрушки-сплюшки) для малышей. Такая игрушка создана для новорождённых и детей постарше, которая станет хорошим другом на протяжении многих месяцев или даже лет.

Как сшить мягкие буквы-подушки своими руками

, Ольга Максимова

Сейчас очень популярны мягкие именные подушки-буквы, которые шьют как одну (начальную букву имени), так и несколько (имя целиком или слово). Такие подушки понравятся не только малышам, но и многим взрослым. Они отлично украсят собой детскую или спальню, добавив комнате тепла и уюта.

Валики-бортики в детскую кроватку (+выкройка)

обновление от , Ольга Максимова

Сегодня я покажу как можно сшить валики-бортики в детскую кроватку.
Всего за 3 вечера получилось 4 валика и 4 съемных чехла к ним. Можно сшить просто валики из ткани с рисунком, в этом случае чехлы не обязательны, но с чехлами удобнее в плане стирки.

Праздничный боди/песочник с воланом

, Ольга Максимова

На улице почти лето и пора готовиться к жарким летним дням. Предлагаю сшить малышкам модный песочник. Выкройка простая, боди (песочник) будет без застежек, только резиночки.

Лоскутное одеяло или покрывало

обновление от , Ольга Максимова

Лоскутное одеяло/покрывало — это стеганое одеяло, одна из сторон которого (или обе стороны) сшита из разноцветных кусочков ткани (стиль пэчворк). Я решила тоже сшить такое одеяло для своей дочки, и вот что у меня получилось.

Одежда для малышей до года (выкройки)

обновление от , Ольга Максимова

В данной статье я покажу, как шить самую распространенную домашнюю и летнюю одежду для малышей до 1 года: полукомбинезон (штанишки на лямках), ползунки, летний костюмчик (футболка и шортики) и другое. Статья будет пополняться.

Пинетки для малышей

, Ольга Максимова

В этой статье я покажу пару способов создания пинеток. Такие пинетки подойдут и для малышей, и для кукол. Одни пинетки теплые из двустороннего флиса с трикотажным манжетом, а вторые джинсовые на завязках.

Детские туфельки-балетки из атласной ткани

обновление от , Ольга Максимова

Если Ваша малышка совсем маленькая и еще не научилась ходить, то нет смысла покупать обувь под платьице на праздник, ее можно сшить. Например, вот такие милые туфельки-балетки, цвет которых можно выбрать под цвет наряда Вашей принцессы.

Детский развивающий коврик

, Ольга Максимова

Каждый родитель хочет, чтобы его ребенок рос и развивался умным, любознательным и счастливым. В этом детям помогают различные развивающие игры и игрушки. Одной из первых развивающих игрушек является развивающий коврик, его можно купить в магазине, а можно и сделать самому. Главное, чтоб на нем были ткани, различных цветов и фактур, шуршалочки, ленточки и многое другое (зависит от вашей фантазии). Я тоже решила сшить такой коврик своей дочке.

Цветочек-погремушка

, Ольга Максимова

Всех маленьких детишек привлекают яркие цвета, шуршащие и гремящие предметы, по-этому детям всегда покупают различные погремушки. Обычно в магазинах продаются пластмассовые, резиновые и сшитые мягкие погремушки, но для разнообразия можно и связать ее, тем более, что это займет всего пару часов.

Одежда для новорожденного своими руками

 

Какое удовольствие получает мама или бабушка, вкладывая частичку своей души и заботы в вещь! В сшитый своими руками, со всей своей любовью, милый комбинезон или ползунки. Сколько времени проведет она за шитьем, наедине с собой и своими мыслями о будущем своего дитя. Это прекрасное время ожидания встречи с чудом! 

Я научу вас шить несложные детские вещи. Такие милые костюмчики, создавая которые вы получите большое удовольствие. Хочу вдохновить вас на творчество для самых своих любимых и родных. Приступим! Скорее за дело.

Я выбрала совсем не сложные модели, но зато очень милые и функциональные. К тому, же на их основе вы сможете сшить много других по своему вкусу.

 

 

Давайте разберемся на какой размер шить. Самое сложное — это оценить какого же размера должна быть одежда для малыша. Вам в помощь вот такая табличка. Размеры в ней примерные, но вы смело можете на них опираться, ведь особенности конструирования детской одежды учитывают большие прибавки для роста и удобства ребенка.

 
















Месяцы

0-1

1-3

3-6

6-9

9-12

Рост, см

45…50-56

56-62

62-68

68-74

74-80

Размер одежды по росту

50-56

57-62

62-68

68-74

74-80

Размер одежды по обхвату груди

18…20-22

22-23

23-24

24-25

25-26

Обхват головы, см

35-39

40-42

42-44

44-45

45-46

Полуобхват груди, см

19-22

22,5-23,5

23,5—24,5

24,5-25,5

25,5-26,5

Полуобхват талии, см

19-22

22,5-23,5

23,5-24,5

24,5-25,5

25,5-26,5

Полуобхват бедер, см

19-22

22,5-23,5

23,5-24,5

24,5-25,5

25,5-27

Длина стопы, см

7-9

9-10

10-11,5

11,5-12,5

12,5-13

Полуобхват шеи, см

10-11

11-11,5

11,5-12

12-12,5

12-12,5

Длина брюк, см

20..23-25,5

25,5-35,5

35,5-41,5

41,5-45

45-50

Длина рукава, см

18..19-23

23-25

25-27

27-29

29-31

Длина спинки, см

14…16

16-18

18-20

20-21,5

21,5-23

Длина от талии до колена, см

7…8-8,5

8,5-9,6

9,6-10,6

10,6-11,7

11,7-12,7

Обхват щиколотки, см

12-13

13,5

14,5

15

15,5

 

Ткани для детского белья нужно брать 100% натуральные. Хлопок, лен. Лучше всего трикотаж — интерлок, футер, рибана, кашкорсе, кулирка.

 

 

 

Первая выкройка комбинезона. Назовем ее базовой. Она совсем не сложная в построении, но на ее основе, вы сможете сшить множество моделей. 

Потребуются размерные признаки из таблички, см. вверху., если вы пока еще не знаете «параметров».  Или, если ребенок уже родился, снимите мерки с него. 

Думаю, что вы без труда разберетесь с построением. Хочу лишь обратить ваше внимание, на сопряжение размера проймы и оката рукава. Они должны быть подходить друг к другу.

  

 

Вот так будут выглядеть детали выкройки. Не забудьте учесть ширину манжет при определении длины штанишек и рукавов.

 

 

 

 

Выкройка такого комбинезона моделируется на основе первой, базовой, выкройки. На деталь переда в развороте нанесите новую линию застежки. 

 

 

Низ штанишек, рукавов , борт застежки и горловину обработайте сложеной вдвое полосой из кашкорсе или рибаны.

Еще модели для вдохновения. 

 

 

 

Вот такое чудесное платье-боди можно сшить по следующей выкройке. Оно очень милое и удобное.

 

                 

 

Низ трусиков обработайте с резинкой. Можно вставить в кулиску, а можно настрочить «зиг загом». Выбирайте в зависимости свойств ткани, ее мягкости.

Можете изменять детали и отделку по своему вкусу. 

 

 

Очень удобные, а главное совершенно простые в исполнении штанишки. Справится любой. Попробуйте.

 

 

Мило, да?)

 

 

 

Куда же без спального комбинезона? Совсем без него не обойтись. Тем более, если он в форме звезды  Очень удобная вещь. Проверено!

 

 

Кстати, из махрового полотна выйдет прекрасное полотенце. Используйте ту же выкройку, просто немного откорректируйте линию борта. Как на рисунке.

 

 

Ваш малыш быстро растет,.Одежки становятся маловаты, но так трудно с ними расстаться.. Решение для таких сентиментальных, как я: смотрите, как классно можно использовать любимый детский костюмчик. Сшить из него игрушку в кроватку! Мне эта идея кажется просто замечательной. Мягкая игрушка — на память об этом неповторимом времени. Таком милом и таком трогательном, но таком коротком. 

 

 

Ну, что вдохновились?) Скорее за дело. А фото ваших работ ждем на нашем фотофоруме. 

 

Детский конверт рыбака — Purpleneedle

(Подарок для детского душа)

Схема вязания

Автор: Амаль Салех

Также известен: Purpleneedle

Это детское одеяло связано как One Rectangular Piece , а затем сложено как конверт, чтобы принять новорожденного и согреть его.

Делаем быстро быстро Подарок для любой будущей мамы.

Для выкройки использовались иглы 7 US и пряжа Worsted весовой категории 4.

Он разработан для новорожденных с по на 1 месяц вместе с инструкциями по изменению размера и приспособлению для более крупных детей.

Уровень навыка:

Легкий средний

Завершенные измерения (немытые / разблокированные):
  • Ширина — 12 ½ ”
  • Длина (в сложенном состоянии) — 20 ½ ”
Иглы и маркеры:
  • Прямой или круглый размер 7 US (4,5 мм)
  • Иглы с двойным острием (DPN) меньше размера 7 US (3.5 мм)
  • Два кольцевых маркера и один съемный маркер (опция)
Пряжа:
  • Данный проект выполнен с использованием пряжи Sincerelyly, Purl Essence Baby. Цвет, Искренне Лаванда.
  • Чтобы заполнить этот конверт, вам может понадобиться около 250 граммов или 474 ярда (1 ½ мотка).
Пуговицы или молнии:
  • Молнии идеально подходят для этого проекта, потому что iCord обеспечивает стабильность, необходимую для пришивания молнии с каждой стороны конверта.Если вы остановились на молнии, вам понадобятся две длиной 12 дюймов.
  • Если вы выбрали пуговицы, купите их после завершения проекта, чтобы убедиться, что они подходящего размера и стиля. Для этого проекта вам понадобится 10 кнопок.

Датчик

(немытый / разблокированный):
  • Подвязка — 4 петли и 4 гребня на дюйм.
  • Ребро рыбака — 4 петли и 8 рядов на один дюйм.
Примечания:
  • Этот образец работает как One Piece и представлен в 3 Parts : Раздел капота, Задняя часть и Передняя часть.
  • Секция капюшона обрабатывается рядами платочной вязки, затем кромка Cast On складывается пополам и соединяется, образуя капюшон.
  • Секция спины выполнена в повторяющемся узоре «Ребра рыбака», окаймлена и прервана подвязками.
  • Передняя часть такая же, как и задняя, ​​с добавлением петель для пуговиц.
  • Все края обработаны непрерывной иглой iCord с использованием Dpns (иглы с двойным острием).
  • Пуговицы, представленные в этом проекте, не пришиты. Они размещены для презентационных предложений.
  • Если вам не удалось найти пряжу, которую я использовал в указанном конверте, любая пряжа Aran или Worsted отлично подойдет для этого проекта.
  • Чтобы избежать аллергии у новорожденного, рекомендуется использовать акриловые или хлопковые волокна.
Стежки и техники:

Перед тем, как приступить к этому проекту, убедитесь, что вы освоили следующие стежки:

  • Кабель на литой или временной основе
  • Платочная вязка
  • Ребро рыбака (K1b, P1)
  • Отверстия для пуговиц
  • Отсоединение 3 игл
  • iCord
Bo Bind Off
Со Литой
К Вязать
K1b Вяжем ниже
К2тог Вяжем вдвоем
п. изнаночная
Повторить Повторять ряды или стежки между круглыми скобками
Гряды Гребни платочной вязки образуются двумя рядами лицевых каждой петли или двумя рядами изнаночной вязки каждой петли.В платочной вязке легче считать гребни, чем ряды.
RS Правая сторона
ССК Слип, Слип, Вязание
СТС Стежки
Йо Пряжа свыше
WS Изнаночная сторона
Узор:

Использование иглы большего размера и троса, или временного литья, Co 51 Sts

рядов Инструкции
R1 — R50 Работа 25 гребней в подвязках

Не обрезайте пряжу в конце этого раздела; просто продолжаем вязать следующий участок

  • Задняя часть (6 повторов рыболовной резинки)
рядов Инструкции
R1 K5, K1b, (P1, K1b) Повторять до последних пяти Sts, K5
R2 K5, P1, (K1b, P1) Повторять до последних пяти Sts, K5
R3 — R18 Повторить R1 и R2
R19 — R24 Работа 3 гребня в подвязке
R25 — R144 Повторите от R1 до R24 еще пять раз или до тех пор, пока кусок не достигнет 21 дюйма от Co.

Не обрезайте пряжу в конце этого раздела; просто продолжаем вязать следующий участок

  • Передняя часть (5 повторов Fisherman’s Ribbing)
рядов Инструкции
R1 — R6 К (работа 3 гребня подвязки)
R7, R9, R11, R13, R17, R19, R21, R23 K5, K1b, (P1, K1b) Повторять до последних пяти Sts, K5
R8, R10, R12, R14, R16, R18, R20, R22, R24 K5, P1, (K1b, P1) Повторять до последних пяти Sts, K5
R15 (отверстие для пуговицы) K1, K2 вместе, Yo, K2, K1b (P1, K1b) Повторять до последних пяти Sts,

К2, Йо, ССК, К1

R25 — R120 Повторите от R1 до R24 еще четыре раза или до тех пор, пока кусок не достигнет 34 дюймов от Co
R121 — R126 K (работа 3 гребня подвязки) Do Not Bo (оставьте стежки живыми на использованной пряже или держателе петель, которые будут использоваться позже в iCord)
Отделка и кромка:
  • Капюшон — Используя иглы меньшего размера (DPN), возьмите стежки с края Cable Co или Provisional Co Edge, сложите пополам и используйте три иглы Bo, чтобы закрыть капюшон и сформировать треугольную форму.
  • iCord — Начните iCord в последнем ряду задней части и завершите его в первом ряду передней части, чтобы при шитье для соединения двух концов iCord концы были скрыты в угловом сгибе конверта.
  • Сложите конверт, как показано на фото, затем добавьте пуговицы или молнии.
Как настроить размер
  • При набирании прибавьте или убавьте 2 стежка, чтобы увеличить или уменьшить ширину этого конверта для ребенка.
  • Каждые дополнительные 4 стежка увеличивают ширину на 1 дюйм.
  • Вы можете увеличить или уменьшить длину, добавив или убрав выступы (2 ряда) из рядов подвязки или 2 ряда из рядов Рыбака.
  • Каждые 4 дополнительных подвязки увеличивают длину на 1 дюйм.
  • Каждые 8 ​​дополнительных ребер Fisherman’s Ribbing увеличивают длину на 1 дюйм.
Как избежать ошибок
  • Передняя и задняя стороны подвязки могут легко перепутать даже опытные вязальщицы. Во избежание путаницы поместите съемный маркер на изнаночную (или правую) сторону при работе с секцией капюшона.
  • В начале секции спины поместите кольцевой маркер после первых пяти петель и перед последними пятью петлями. Это поможет напомнить опытному вязальщице внутри вас, что вы начинаете или заканчиваете ребро рыбака.

Нравится:

Нравится Загрузка …

Связанные

Восприятие речи при рождении: мозг кодирует быструю и медленную временную информацию

Abstract

Восприятие речи ограничено слуховой обработкой.Хотя при рождении младенцы имеют незрелую слуховую систему и ограниченный языковой опыт, они демонстрируют замечательные навыки восприятия речи. Чтобы оценить способность новорожденных обрабатывать сложные акустические сигналы речи, мы объединили ближнюю инфракрасную спектроскопию (NIRS) и электроэнцефалографию (ЭЭГ) для измерения реакции мозга на слоги, различающиеся согласными. Слоги были представлены в трех условиях, сохраняющих (i) исходную временную модуляцию речи [как амплитудную модуляцию (AM), так и частотную модуляцию (FM)], (ii) как быструю, так и медленную AM, но не FM, или (iii) только самый медленный AM (<8 Гц).Ответы ЭЭГ показывают, что новорожденные могут кодировать согласные в любых условиях, даже без быстрых временных модуляций, как и взрослые. Тем не менее, быстрый и медленный AM активируют разные нервные области, как показывает NIRS. Таким образом, незрелый мозг человека уже способен разлагать акустические компоненты речи, закладывая основы изучения языка.

ВВЕДЕНИЕ

Восприятие речи требует эффективных слуховых механизмов для отслеживания тонких различий в сложной комбинации спектральной и временной информации, различающей языковые контрасты.Хотя у младенцев незрелая периферическая и центральная слуховая система ( 1 , 2 ), они с рождения демонстрируют прекрасные способности к восприятию речи ( 3 6 ). Как они могут этого добиться и полагаются ли они на ту же акустическую информацию, что и взрослые, остается неизвестным. Настоящее исследование исследует, используют ли новорожденные младенцы временную информацию в речевом сигнале для различения фонем и если да, то как.

Временная информация играет важную роль в восприятии речи у взрослых.Речь в основном передается в мозг через базилярную мембрану в улитке, внутреннем ухе, которая кодирует временные модуляции речевого сигнала в различных частотных областях или диапазонах ( 7 ). В каждой полосе частот временные свойства извлекаются в двух временных масштабах: сигналы амплитудной модуляции (AM), также называемые временной огибающей, соответствующие относительно медленным изменениям амплитуды во времени, и сигналы частотной модуляции (FM), также называемые временными. тонкая структура, соответствующая изменениям мгновенной частоты вблизи центральной частоты (CF) полосы частот.

Это временное разложение наблюдается на корковом уровне у взрослых. Предыдущие исследования, измеряющие активацию мозга для неречевых звуков, модулированных по амплитуде с разной скоростью, показали преобладающие корковые ответы на самые низкие частоты AM (от 4 до 8 Гц) и полушарную специализацию в кодировании временной огибающей, а также разницу во времени активации между медленной (<16 Гц) и быстрой (<128 Гц) частотой AM ( 8 , 9 ). Что касается речевых звуков, дискуссии о полушарной специализации различных акустических свойств речевого сигнала продолжаются ( 10 ), но обычно предполагается, что быстрая временная модуляция преимущественно обрабатывается левой слуховой корой, в то время как медленная временная модуляция и / или или спектральная модуляция обрабатывается правой височной корой ( 11 , 12 ).

Эти временные модуляции также играют разные роли для восприятия речи, поскольку разные скорости модуляции передают разную лингвистическую информацию. Множество исследований в области психоакустики показали, что самые медленные сигналы огибающей (ниже 16 Гц) играют первостепенную роль в идентификации согласных, гласных и слов в речи, представленной тихо ( 13 , 14 ). Более быстрые сигналы огибающей (ближе к основной частоте голоса) и временная тонкая структура играют более важную роль в восприятии высоты звука, что, в свою очередь, способствует пониманию речи в шуме, а также языковых единиц, сильно зависящих от информация о высоте тона, например лексический тон ( 7 , 15 , 16 ).

Эти нейровизуализационные и поведенческие исследования были сосредоточены только на взрослых слушателях со зрелыми слуховыми и языковыми системами. Однако слуховой системе требуются годы, чтобы созреть. Таким образом, возможно, что незрелая слуховая система младенцев расшифровывает звук иначе, чем у взрослых. Если это так, это имеет важные последствия для языкового развития, которое также разворачивается в течение первых лет жизни, поскольку его слуховой ввод будет отличаться от того, что воспринимают взрослые при обработке речи.В настоящее время у нас очень мало знаний о том, как самые маленькие ученики воспринимают акустические детали речи. Настоящее исследование направлено на восполнение этого пробела.

Несколько существующих поведенческих исследований с младенцами ( 17 21 ) показывают, что шестимесячные дети могут взвешивать сигналы модуляции иначе, чем взрослые. Хотя 6-месячные французские младенцы, как и взрослые, могут использовать речевую оболочку для различения согласных на основе голоса, например in / aba / — / apa /, и места артикуляции, например in / aba / — / ada / in тихие, им требуется больше времени, чтобы привыкнуть к речевым звукам, содержащим только огибающие ниже 16 Гц, чем к речевым звукам, сохраняющим более быстрые модуляции.Более того, трехмесячные младенцы и взрослые по-разному полагаются на быстрые и медленные сигналы AM в тишине и в шуме ( 21 ). Младенцы нуждаются в быстрых AM-сигналах (> 8 Гц) как в тишине, так и в шуме при различении взрывных согласных, в то время как самые медленные AM-сигналы (<8 Гц) достаточны для взрослых в тишине, но им также нужны более быстрые модуляции шума. Эти результаты предполагают, что быстрые огибающие сигналы могут быть важны для восприятия согласных у младенцев даже в тишине.

Нейронные основы слуховой обработки временных модуляций еще недостаточно изучены в младенчестве и никогда не исследовались с использованием сложных акустических сигналов, таких как речь.Одно исследование, посвященное изучению нейронных реакций новорожденных на неречевые звуки с разной височной структурой, показало, что во взрослом возрасте у новорожденных проявляются разные нейронные реакции на медленные (~ 3-8 Гц) и быстро модулированные сигналы (~ 40 Гц) с более выраженными двусторонними временными характеристиками. активация последнего ( 22 ), измеренная с помощью ближней инфракрасной спектроскопии (NIRS), хотя слуховые вызванные потенциалы, зарегистрированные с помощью электроэнцефалографии (ЭЭГ), не различались. Ни в одном исследовании не проводилось прямое сравнение восприятия новорожденными медленной и быстрой временной модуляции речи.Таким образом, взаимодействие между слуховыми механизмами и восприятием речи на ранних этапах развития человека остается в значительной степени неизученным.

Чтобы определить, как новорожденные младенцы, у которых мало опыта общения с родным языком и незрелой слуховой системой, обрабатывают временные акустические сигналы речи для восприятия согласных звуков, мы использовали два до сих пор редко комбинированных подхода. Мы объединили обработку речи вокодером с визуализацией мозга, чтобы проверить, как новорожденные обрабатывают и воспринимают временные модуляции речи, необходимые для разборчивости речи во взрослом возрасте.Вокодеры — это мощные инструменты анализа и синтеза речи, которые могут выборочно управлять спектрально-временными свойствами звука ( 14 ). Мы использовали вокодер, чтобы выборочно манипулировать простыми слогами C (онсонант) -V (owel) в трех условиях: (i) «неповрежденное» состояние сохраняло как временную огибающую, так и временную тонкую структуру, близко соответствуя исходному сигналу и служило контроль за манипуляциями вокодирования; (ii) «быстрое» состояние сохраняло как быструю, так и медленную компоненты огибающей, таким образом сохраняя некоторую информацию о тональности голоса и форманте (<500 Гц), но подавляло временную тонкую структуру; и (iii) «медленное» состояние сохраняло только самую медленную временную огибающую (<8 Гц), сохраняя в основном модуляции, относящиеся к слогам ( 23 ).Группа 2-дневных, здоровых доношенных новорожденных-французов слышала слоги, различающиеся по своим согласным (/ pa / — / ta /) в этих трех условиях (рис. 1). Мы записали ответы мозга новорожденных на эти звуки речи, комбинируя ЭЭГ и NIRS (рис. 2), чтобы оценить электрофизиологический ответ мозга и его метаболические корреляты, соответственно. Сочетание этих двух методов, которое раньше редко применялось у маленьких детей ( 22 , 24 ), имеет уникальное преимущество, так как обеспечивает как точную пространственную локализацию, так и высокое временное разрешение.

Рис. 1 Осциллограммы и спектрограммы односложного экземпляра.

Осциллограммы (верхние строки) и спектрограммы (нижние строки) / pa /, отфильтрованные в состоянии Неповрежденный (AM + FM) слева, Fast AM (AM N /2) в середине и состояние Slow AM (AM <8 Гц) справа.

Рис. 2 Размещение оптодов БИК и электродов ЭЭГ.

( A ) Схематическое изображение источников света ближнего ИК-диапазона (красные кружки) и детекторов (синие кружки).Пунктирные овалы представляют каналы NIRS (т. Е. Связанные источники и детекторы). Электроды ЭЭГ показаны сплошными кружками. ( B ) Конфигурация наборов датчиков, наложенных на схематическое изображение мозга новорожденного. Для каждого функционального канала NIRS (fNIRS), расположенного в этом наборе датчиков, идентичность подлежащей области мозга (с использованием атласа LPBA40) иллюстрируется в соответствии с их локализацией. Синие каналы указывают положение зонда над лобной областью, оранжевые каналы над теменной областью, а пурпурные — над височной областью на голове младенца.Серые кружки указывают на источники, а черные кружки — на детекторы. ( C ) Изображения колпачка на модели новорожденной куклы (фото предоставлено Юдит Гервейн, Центр интегративной нейробиологии и познания).

Пока новорожденные спокойно лежали в своих больничных кроватках, слоги передавались им через громкоговорители длинными блоками стимуляции (30 с) по шесть блоков на состояние (рис. 3), удовлетворяя временным требованиям медленной гемодинамической реакции, измеренной с помощью NIRS.Неповрежденный звук всегда воспроизводился в последнюю очередь, чтобы избежать заправки, в то время как порядок медленных и быстрых условий был уравновешен для младенцев. Каждый блок содержал 25 слогов, из которых 20 были стандартными (например, / pa /), а 5 — отклоняющимися (например, / ta /), что позволяло оценивать ответы на отдельные слоги внутри блоков, связанные с событиями, аналогично классическому чудаку. или несовпадение дизайна в исследованиях ЭЭГ ( 25 ). Таким образом, каждый блок стимуляции содержал 80%: 20% стандартных и отклоняющихся звуков.Единственная разница между стандартными и отклоняющимися звуками — это согласная в начале слога. Первые пять звуков всегда были стандартами, позволяющими сформировать ожидания относительно стандарта. Стандартные и девиантные слоги у младенцев уравновешивались. Такой дизайн позволил нам ответить на два исследовательских вопроса: во-первых, обрабатывает ли мозг новорожденного медленные, быстрые и неповрежденные состояния одинаково или по-разному, как показано путем сравнения гемодинамических реакций на три состояния; и, во-вторых, могут ли новорожденные успешно различать согласные на основе временных акустических сигналов, присутствующих в каждом из состояний, которые индексируются связанными с событием ответами ЭЭГ на стандартный слог в сравнении с девиантным.

Рис. 3 Схема экспериментального дизайна.

Каждый младенец слушал три звуковых состояния в 18 последовательных блоках в течение примерно 22 минут (шесть блоков на каждое условие). Состояние «Неповрежденный» всегда игралось последним, а порядок условий «Медленный» и «Быстрый» был уравновешен между младенцами. В каждом блоке игралось 25 слогов по парадигме «нечетного шарика» с 20% отклоняющихся слогов.

Изменения гемодинамических ответов регистрировали с помощью оптических датчиков NIRS, расположенных на левой и правой лобно-височных областях головы новорожденных (рис.2). Эта локализация была основана на предыдущих исследованиях NIRS, проверяющих восприятие речи у новорожденных ( 5 , 26 ). Было проведено два типа анализа записанной гемодинамической активности, измеряемой как изменения концентрации оксигенированного (oxyHb) и деоксигенированного (deoxyHb) гемоглобина в зависимости от слуховой стимуляции. Сначала был проведен кластерный анализ перестановок с использованием тестов t для парных выборок для сравнения изменений концентрации с нулевым исходным уровнем в каждом нормальном состоянии.Для прямого сравнения трех условий был проведен кластерный тест перестановки с использованием одностороннего дисперсионного анализа (ANOVA). Результаты были дополнены тестами на перестановку с использованием тестов и для парных выборок, чтобы определить, какие парные сравнения повлияли на эффекты в тесте перестановки, содержащем ANOVA. Эта серия анализов помогла определить временные окна и интересующие области мозга (ROI), показывающие значительную активацию слуховых стимулов на основе данных.Более того, тесты на перестановку имеют то преимущество, что они контролируют множественные сравнения без потери статистической мощности, что обычно происходит, когда поправки Бонферрони или другие поправки применяются к данным NIRS для младенцев ( 27 ). Затем были использованы линейные модели смешанных эффектов для оценки влияния звуковых условий (Интактный / Быстрый / Медленный), блока стимуляции (от 1 до 6) и ROI, полученного в результате перестановочных тестов, на зарегистрированные изменения концентрации oxyHb. Электрофизиологические ответы регистрировали с электродов ЭЭГ, расположенных спереди-центрально на голове новорожденного (F3, F4, Cz, C3 и C4 по системе 10-20; рис.2). Эта локализация была основана на предыдущих исследованиях совместной записи ЭЭГ и EEG-NIRS, в которых проверялось восприятие речи у новорожденных ( 28 ). Амплитуда ответов ЭЭГ была усреднена в каждом состоянии вокодера независимо для стандартных звуков и отклоняющихся звуков. Затем в каждом состоянии вокодера использовалась линейная модель смешанных эффектов, чтобы оценить, вызывают ли два типа слогов разные ответы ЭЭГ, известные как реакция несоответствия, отражающая обнаружение слуховых изменений.

Мы предсказали, что гемодинамическая активность новорожденных должна быть схожей в интактных и быстрых условиях, если младенцы могут полагаться на быструю временную оболочку для распознавания фонем, как предполагают предыдущие исследования с участием детей в возрасте от 3 до 6 месяцев ( 20 , 21 ).Напротив, медленное состояние может не передать достаточно тонких акустических деталей, чтобы мозг новорожденного обработал его так же, как исходный сигнал. В частности, для различения фонем в качестве меры достоверности нашего дизайна мы ожидали значительного различия между стандартными и отклоняющимися слогами в неповрежденном состоянии, поскольку младенцы, как известно, способны различать слоги, различающиеся согласным ( 29 ). Несоответствие реакции в двух других условиях могло бы указывать на то, что младенцы также могут обнаруживать изменение согласной, используя ухудшенные речевые сигналы.

РЕЗУЛЬТАТЫ

Как временная информация в речи обрабатывается мозгом новорожденного: функциональные результаты NIRS

Общие средние результаты OxyHb NIRS для 23 протестированных новорожденных показаны на рис. 4A (для простоты изложения результаты deoxyHb показаны отдельно ; рис. S1). Кластерные тесты перестановки ( 26 , 28 ), сравнивающие каждое условие с исходным уровнем, показали значительные изменения в концентрациях oxyHb во временном окне между 5 и 25 секундами после начала стимуляции.Как показано на фиг. 4A, активация значительно отличалась от базовой в каналах 8 (LH) и 21 (RH) для интактного состояния, в каналах 1, 3, 4, 6 и 12 (LH) и 14 и 17 ( RH) для быстрого состояния и в каналах 3 (LH) и 16 и 17 (RH) для медленного состояния (для всех тестов перестановки, P <0,0001). Для быстрого состояния эти значимые результаты указывают на дезактивацию (отрицательный ответ на оксигидрат), тогда как для интактного и медленного состояний активация была больше, чем исходный уровень.Аналогичный анализ концентраций дезокси-Hb показал значительные изменения в интактном состоянии по сравнению с исходным уровнем (в канале 9 между 13 и 25 с после начала стимуляции и в канале 21 между 10 и 16 с) и значительные изменения в быстром состоянии по сравнению с исходным уровнем (в канале 11 между 28 и 32 с). Для медленного состояния не наблюдалось значительной активации по сравнению с исходным уровнем.

Рис. 4 Вариации oxyHb.

( A ) Концентрация OxyHb изменяется по блокам стимуляции в каждом канале и в каждом полушарии.Ось x представляет время в секундах, а ось y представляет концентрацию в миллимоль-миллиметрах. Прямоугольник по оси x указывает время стимуляции. Черные линии представляют концентрацию для неповрежденного состояния, красные — для быстрого состояния и оранжевые — для медленного состояния. Цветовая кодировка * представляет каналы, отличающиеся от базового уровня для каждого состояния ( P <0,05). ( B ) Сравнение условий значительно активированных каналов в соответствии с тестом перестановки ( P <0.05).

Кластерные перестановочные тесты также использовались для сравнения изменений в концентрации oxyHb в разных условиях. Как показано на фиг. 4B, тест перестановки, сравнивающий все три условия в одностороннем дисперсионном анализе, выявил значительные различия между условиями в каналах 1, 3, 4, 6 и 24 ( P <0,01). Из них каналы 3, 4 и 6 сформировали пространственный кластер в LH и канал 24 в RH ( P <0,01). Чтобы продолжить дисперсионный анализ, мы провели тесты перестановки с тестами t парной выборки, сравнивая условия попарно.Неповрежденное состояние вызывало значительно большую активацию, чем состояние Быстрое, в каналах 1, 3 и 4 ЛГ и в каналах 14, 22, 23 и 24 правой руки. Из них каналы 1 и 3 сформировали пространственный кластер в правой части ( P = 0,027) и каналы 22 и 24 в правой ( P = 0,046). Ответы в медленном состоянии были значительно выше, чем в интактном состоянии в канале ЛГ 1 ( P = 0,039) и RH канале 22 ( P = 0,035). Состояние Slow вызвало значительно большую активацию, чем состояние Fast, в каналах LH 1, 3, 4 и 6 и в каналах RH 14 и 17 ( P <0.01). Из них каналы 1, 3 и 4 в LH сформировали статистически значимый пространственный кластер ( P = 0,016), в то время как каналы 14 и 17 сформировали незначительный кластер в RH ( P = 0,065). Кроме того, не было обнаружено значительных различий в изменениях дезокси-Hb между тремя состояниями (рис. S1). Следовательно, по данным deoxyHb не проводился грандиозный дисперсионный анализ.

На основе результатов теста перестановки на основе ANOVA по концентрации oxyHb мы выбрали лобно-височные каналы 1, 3, 4 и 6 в LH и 14, 16, 17 и 19 в RH как Рентабельность инвестиций для линейной модели смешанных эффектов.Каналы 1, 3, 4 и 6 в LH были идентифицированы как ROI с помощью кластерного теста перестановки, сравнивающего три условия, и чтобы иметь сбалансированный статистический тест, мы использовали аналогичные каналы в RH в качестве ROI для этого. полушарие. Затем модели линейных смешанных эффектов были проанализированы с учетом изменений средней концентрации оксиген урана между 5 и 25 секундами после начала стимуляции, то есть временного окна, определенного кластерными перестановочными тестами, для оценки эффектов состояния (неповрежденное, быстрое или медленное), Полушарие (левое против правого), канал (4 на полушарие) и блок стимуляции (от 1 до 6).Из всех построенных возможных моделей наиболее подходящая включала фиксированные факторы «Условие» и «Блок» с участниками в качестве случайного фактора. Эта модель выявила основной эффект от условия ( F 2,2474 = 10,62, P <0,001; интактное против быстрого, P <0,001; быстрое против медленного, P <0,001; интактное против медленного, P = 0,62), Блок ( F 5,2472 = 4,13, P <0,001) и взаимодействие Условие × Блок ( F 10,2473 = 3.69, P <0,001). Основной эффект от условия был связан с большей реакцией в неповрежденном и медленном состоянии, чем в быстром. Основной эффект блока отражал постепенное снижение нейронной активности в более поздних блоках в результате нейронного привыкания, часто наблюдаемого в ответах младенцев на NIRS ( 30 ). Взаимодействие между блоком и условием показало, что концентрации oxyHb в интактных и медленных условиях различаются в блоке 1 и что активация в быстрых и медленных условиях различается в блоке 3, как показано на рис.5.

Рис. 5 Вариации oxyHb при блоках стимуляции.

Усредненная концентрация oxyHb как функция блоков стимуляции в каждом состоянии вокодера в ROI (среднее значение каналов 1, 3, 4, 6, 14, 16, 17 и 19). Планки погрешностей представляют 1 SE.

В целом, разные реакции наблюдались в трех состояниях вокодера, при этом состояния медленного и неповрежденного вызывали положительную активацию в основном в левой лобно-височной области, а состояние «быстрое» приводило к постепенной деактивации с течением времени с обеих сторон.

Различение фонем на основе ухудшенных речевых сигналов: результаты ЭЭГ

На рисунке 6 показано общее среднее значение ответов ЭЭГ, записанных на F3 для стандартных и девиантных согласных в каждом состоянии. Мы запустили линейные модели смешанных эффектов с фиксированными коэффициентами Тип испытания (стандартный / отклоняющийся) и окно (восемь интервалов), чтобы оценить, различалась ли амплитуда ответа ЭЭГ, записанного для стандартных и отклоняющихся звуков, между 300 и 700 мс после появления стимула, что обычно является обычным. временное окно для эффектов рассогласования различения фонем ( 31 ).Это временное окно было разделено на восемь интервалов по 50 мс для оценки задержки нейронных ответов. В каждом условии наиболее подходящая модель включала фиксированные факторы Тип исследования и Окно с участниками в качестве случайного фактора. Во всех трех условиях наблюдался значительный главный эффект пробного типа, указывающий, что девиантные и стандартные согласные вызывали разные активации в каждом звуковом состоянии (Неповрежденный: F 1,270 = 5,22, P = 0,023, η 2 = 0.019; Быстро: F 1,270 = 16,69, P <0,001, η 2 = 0,058; Медленно: F 1,270 = 8,37, P = 0,004, η 2 = 0,03). Ответ о несоответствии был положительным в неповрежденном состоянии, но отрицательным в условиях быстрого и медленного. Основной эффект Window также наблюдался в неповрежденных и медленных условиях ( F 7270 = 2,238, P = 0,032, η 2 = 0,055; F 7270 = 2.483, P = 0,017, η 2 = 0,06 соответственно) из-за большего количества положительных откликов в последних временных окнах (от 500 до 700 мс) по сравнению с первыми (от 300 до 450 мс). Этот эффект был незначительным в условиях Fast ( F 7270 = 2,004, P = 0,055, η 2 = 0,049). Взаимодействие типа испытания × окно не наблюдалось ни при каких условиях (Неповрежденный: F 7270 = 0,313, P = 0,948; Быстрый: F 7270 = 0.811, P = 0,578; Медленно: F 7270 = 0,079, P = 0,99). Таким образом, в каждом из условий реакция на Девиант отличалась от Стандартной, начиная с 300 до 700 мс после появления стимула.

Рис. 6 Общее среднее значение ответов ЭЭГ.

Групповые средние изменения амплитуды (мкВ) ответов ЭЭГ, зарегистрированных в F3 для Стандартного (зеленые линии) и Девиантного (пурпурные линии) в каждом состоянии для группы новорожденных, подвергшихся изменению согласных.Отклики на стандартные и отклоняющиеся отклики отличаются друг от друга в каждом состоянии во временном окне от 300 до 700 мс, представленном серым прямоугольником.

ОБСУЖДЕНИЕ

Настоящее исследование совместной регистрации NIRS-EEG показывает, что, как и взрослым, новорожденным не требуется тонкая временная структура и информация быстрого конверта для различения согласных в тишине. Однако быстрые и медленные компоненты речевого конверта обрабатываются по-разному при рождении.

Во-первых, электрофизиологические результаты демонстрируют, что мозг новорожденного способен обнаруживать изменение места артикуляции между двумя французскими заглушенными согласными, что демонстрируется несоответствием ответа ЭЭГ в интактном состоянии.Как и в некоторых предыдущих исследованиях с младенцами младшего возраста, мы наблюдали положительный ответ несоответствия ( 32 ). Новорожденные также смогли обнаружить изменение согласных на основе сигналов огибающей без тонкой временной структуры, а также на основе только медленных временных изменений (AM <8 Гц). Эти результаты согласуются с поведенческими данными, полученными с младенцами старшего возраста и взрослыми ( 13 , 14 , 20 , 21 ), для которых самых медленных огибающих сигналов также достаточно для обнаружения изменений согласных в тишине.Однако направление реакции рассогласования различалось в интактных и деградированных условиях. В предыдущих исследованиях наблюдалась разная полярность девиантных звуков в зависимости от конструкции, межстимульного интервала или электрода сравнения ( 33 ). Эти методологические факторы не могут объяснить наши результаты, поскольку разница полярностей произошла в рамках одного исследования. Инверсия полярности также наблюдалась у младенцев в зависимости от сложности задания, например, для более сложных акустических различий, например, для небольших различий в высоте тона ( 34 ).Это означает, что сложность обнаружения изменений в Неповрежденном состоянии могла быть различной по сравнению с двумя ухудшенными состояниями. Эта гипотеза требует дальнейшего изучения в разном возрасте, чтобы проследить роль временных модуляций в восприятии речи на раннем этапе развития.

Однако обратите внимание, что, хотя различение было возможно во всех трех условиях, на что указывают потенциалы мозга, сигналы полной и медленной огибающей обрабатывались по-разному. Гемодинамические ответы различались по величине, течению времени и локализации в зависимости от состояния вокодера, то есть в зависимости от временной информации, доступной в речевом сигнале.Точнее, записи NIRS выявили двустороннюю активацию для медленного состояния и более левостороннюю активацию для быстрого состояния. Этот другой паттерн активации может отражать специализацию мозга взрослого человека на медленные и быстрые сигналы модуляции уже при рождении. Предыдущие исследования у взрослых показывают, что медленные модуляции преимущественно активируют правое полушарие, тогда как более быстрые временные модуляции предпочтительно активируют левое полушарие ( 8 , 9 , 35 , 36 ), хотя некоторые недавние модели называют это простым Под вопросом разделение труда ( 10 ).У взрослых быстрые и медленные скорости временной оболочки обрабатываются как отдельными, так и общими нейронными субстратами. Одно нейровизуализационное исследование с использованием звуков озвученной речи показало аналогичную активацию для исходной речи и речи с шумовым вокодом, сохраняя медленную и быструю AM (<320 Гц, извлеченную по шести каналам) в верхней височной извилине, но несходную активацию в верхней височной борозде (). 37 ), демонстрируя, что обработка полного речевого сигнала и быстрых AM-сигналов не требует одинаковой нейронной обработки у взрослых.Прямое сравнение медленной и быстрой модуляции у взрослых с использованием звуков речи не проводилось. Для неречевых звуков, например, белого шума, исследования функциональной магнитно-резонансной томографии обнаружили разные реакции мозга между частотами AM ниже 16 Гц и выше 128 Гц ( 8 ). Более конкретно, медленная и высокая скорость огибающей в неречевых звуках активировала одни и те же области коры (верхняя височная извилина и борозда), но временные ходы активации различались в зависимости от скорости АМ. Ответы, записанные с двух сторон в извилине Хешля, были настроены на самую медленную частоту AM, 8 Гц, и было показано, что более быстрые модуляции неречевых звуков активируют преимущественно LH ( 9 ).Настоящие результаты предоставляют уникальное понимание, показывающее, что мозг новорожденного также демонстрирует дифференциальную обработку для разных скоростей AM в речи, и предполагают, что дифференциальная специализация полушария для обработки медленной и быстрой информации о конвертах уже присутствует при рождении. Таким образом, человеческий мозг уже с самого начала настроен на быструю и медленную AM-информацию в речи, закладывая основы для последующего изучения языка и понимания речи.

Обратите внимание, что динамика гемодинамических ответов была более сходной между интактными и медленными состояниями, чем между интактными и быстрыми состояниями.Это удивительно, учитывая, что медленное состояние более акустически ухудшено, то есть менее похоже на неповрежденное состояние, чем быстрое. Деактивация (отрицательный ответ oxyHb) часто наблюдается в исследованиях новорожденных ( 30 ) и может быть связана с нейронным привыканием из-за повторения стимулов. В настоящем исследовании возможно, что резкое снижение гемодинамической реакции с течением времени в быстром состоянии может отражать более быстрое нейронное привыкание в этом состоянии, чем в двух других состояниях.Эта деактивация не может быть связана с системными изменениями кровотока, потому что быстрые и медленные состояния были представлены в уравновешенном порядке. Этот результат согласуется с предыдущими исследованиями с использованием неречевых звуков ( 22 ), показывающих специфический нейронный ответ для относительно быстрых временных модуляций (изменение каждые 25 мс, что эквивалентно колебаниям ~ 40 Гц), но не для более медленных модуляций у новорожденных. . Более того, недавнее исследование магнитоэнцефалографии показало, что плоды способны обнаруживать медленные и быстрые частоты AM (от 2 до 91 Гц), модулирующие неречевые звуки, и что они показывают самый высокий отклик на 27-Гц модуляции, которые, как предполагается, лучше передаются костями. проводимость, чем более медленные темпы AM ( 38 ).Ответы на 4 Гц постепенно нарастали на 31-й и 39-й неделях беременности. Развитие этих специфических слуховых реакций еще не было однозначно связано с развитием восприятия речи. Можно предположить, что нынешние реакции на относительно быстрые временные модуляции речи, наблюдаемые при рождении, могут отражать то, что младенцы в большей степени зависят от сигналов быстрой огибающей, чем от любых других сигналов модуляции. Поскольку быстрые огибающие сигналы несут больше информации об основной частоте и переходах формант, которые замедляют огибающие сигналы, этот специфический ответ может соответствовать ранней способности младенцев обнаруживать фонетические различия и их предпочтению преувеличенным просодическим сигналам ( 39 ).Хотя мы не можем быть уверены, что нынешние озвученные слоги были обработаны как речь, есть два свидетельства, указывающих в этом направлении. Во-первых, существует перекрытие в локализации активированных каналов в трех состояниях, включая неповрежденное состояние, которое, несомненно, является речью. Во-вторых, эти активированные каналы находятся во височных и нижних лобных областях, то есть в слуховой и языковой сети. Тот факт, что активация была двусторонней, не является аргументом против обработки звуков как речи, поскольку двусторонняя активация в ответ на речь обычно наблюдается у новорожденных ( 40 , 41 ).

Необходимы будущие исследования с младенцами, чтобы полностью охарактеризовать созревание слухового пути, чтобы лучше понять взаимодействие между развитием слуха и развитием речи. В течение первого года жизни младенцы лучше распознают речевые контрасты своего родного языка, но не демонстрируют такого же улучшения в отношении контрастов неродных ( 42 ). Это явление называется настройкой восприятия или речевой специализацией. Возможно, что с определенным слуховым опытом слушатели учатся игнорировать определенные акустические сигналы речи, не имеющие отношения к развитию категорий родного языка ( 20 ).Таким образом, зависимость от быстрых речевых сигналов AM может измениться с увеличением воздействия звуков естественной речи. Для изучения этой гипотезы необходимы дополнительные исследования, сравнивающие зависимость от акустических сигналов речевого сигнала на раннем этапе развития. Преимущество психоакустического подхода для психолингвистических исследований заключается в описании роли тонких спектральных и временных модуляций, которые имеют нейрокорреляты в слуховой системе, для восприятия речи. Таким образом, этот подход предлагает прекрасную возможность точно охарактеризовать слуховые сенсорные механизмы, участвующие в обработке речи на раннем этапе развития, то есть в критический период для языкового развития.

В целом, наше исследование демонстрирует, что слуховая система человека способна кодировать речь в мельчайших деталях на основе сильно сокращенной акустической информации, особенно самых медленных сигналов AM, уже с рождения. Более того, мозг новорожденного уже демонстрирует значительную специализацию в отношении различных временных сигналов в речевом сигнале, закладывая основы удивительно сложного восприятия речи и способностей младенцев к изучению языка.

МАТЕРИАЛЫ И МЕТОДЫ

Участники

Новорожденные, рожденные в сроке гестации от 37 до 42 недель, с оценкой по шкале Апгар ≥8 в первую и пятую минуту после рождения, окружностью головы более 32 см и неврологическими заболеваниями. или нарушения слуха, были набраны для исследования в родильном отделении больницы Роберта Дебре, Париж, Франция.Слух новорожденных оценивался путем измерения слуховых реакций ствола мозга во время их пребывания в больнице. Исследование было одобрено комитетом по этике исследований Университета Париж-Декарт (утверждение CERES № 2011-13), и все родители предоставили письменное информированное согласие перед участием.

Была протестирована группа из 74 здоровых доношенных новорожденных (средний возраст 1,8 дня; диапазон от 1 до 4 дней). Тринадцать новорожденных не завершили исследование из-за плача ( n = 10) и родительского / внешнего вмешательства ( n = 3).Из 61 младенца, завершившего исследование, 7 были исключены из анализа NIRS из-за технических проблем во время записи и 31 из-за низкого качества данных (большие артефакты движения или шум). Всего в функциональный анализ NIRS (fNIRS) были включены 23 новорожденных (16 девочек). Из 61 завершившего 3 были исключены из анализа ЭЭГ из-за технических проблем и 38 из-за низкого качества данных (артефактов). Таким образом, в анализ ЭЭГ было включено 20 новорожденных (11 девочек).Матери всех младенцев говорили по-французски во время беременности, но 10 также говорили на втором языке примерно в 50% случаев (арабский, бамбара, итальянский, кабильский, мандаринский, португальский, сонинке или суахили).

Stimuli

Восемь естественных вхождений слогов / pa / и / ta / были записаны носителем французского языка, которому было дано указание говорить четко. Все токены были сопоставимы по длительности (среднее = 194 мс, SD = 14 мс) и F0 (213 Гц, SD = 4 Гц). Все стимулы были приравнены к глобальному среднеквадратичному уровню (RMS).Каждый стимул обрабатывался в трех условиях вокодера. В частности, были разработаны три разных вокодера с возбуждением тоном. В каждом состоянии исходный речевой сигнал пропускался через набор из 32 гамматоновых фильтров второго порядка ( 43 ), каждый шириной 1-эквивалент прямоугольной полосы (ERB), с CF, равномерно разнесенными по шкале ERB в диапазоне от 80 до 8020 Гц. Затем к каждому речевому сигналу, прошедшему полосовую фильтрацию, применялось преобразование Гильберта, чтобы выделить компонент огибающей и несущую с тонкой временной структурой.Компонент огибающей был отфильтрован нижними частотами с использованием фильтра Баттерворта с нулевой фазой (спад 36 дБ / октава) с частотой среза, установленной на ERB N /2 (неповрежденное и быстрое состояние) или 8 Гц (медленное состояние). ). В условиях Fast и Slow несущая временной тонкой структуры в каждой полосе частот была заменена несущей синусоидальной волны с частотой, соответствующей CF гамматонового фильтра, и случайной начальной фазой. Затем каждая несущая тона умножалась на соответствующую отфильтрованную функцию огибающей.В неповрежденном состоянии исходная временная тонкая структура была умножена на отфильтрованную огибающую функцию в каждой полосе. Затем были суммированы узкополосные речевые сигналы, и уровень широкополосного речевого сигнала был отрегулирован так, чтобы иметь то же среднеквадратичное значение, что и входной сигнал в каждом состоянии. Таким образом, в неповрежденном состоянии результирующий речевой сигнал содержал исходную огибающую и исходную тонкую временную структуру в 32 полосах. В состоянии Fast обработка вокодером отбрасывала исходные (внутри канала) метки тонкой временной структуры, но сохраняла метки быстрой огибающей (частота среза установлена ​​на ERB N /2).В медленном состоянии манипуляция отбрасывала как исходную временную тонкую структуру, так и сигналы быстрой огибающей, чтобы сохранить только информацию о самой медленной огибающей в каждой полосе (<8 Гц). Таким образом, слоговая информация сохранялась в обоих условиях, но информация о тональности голоса и переходе формант сохранялась только в режиме Fast и резко снижалась в состоянии Slow.

Оборудование и процедура

Оптическая визуализация была выполнена на аппарате NIRScout 816 (NIRx Medizintechnik GmbH, Берлин, Германия) с использованием импульсного светоизлучающего диода (LED) последовательного освещения с двумя длинами волн 760 и 850 нм для записи сигнала NIRS. в 15.Частота дискретизации 625 Гц. По три светодиодных источника размещали с каждой стороны головы в аналогичных положениях и освещали последовательно. Они были соединены с четырьмя детекторами с каждой стороны головы. Конфигурация 16 каналов (8 на полушарие), созданных с тремя источниками и четырьмя детекторами на полушарие, показана на рис. 2. Мы встроили оптоды в эластичный колпачок (EasyCap). Расстояние между источником и детектором составляло 3 см. Для каждого младенца мы выбрали размер шапочки в соответствии с окружностью головы.Мы также отрегулировали колпачок в соответствии с размером Cz и положением уха. Анализ локализации головного убора для новорожденных был выполнен, как в ( 26 ). Электрофизиологическая запись выполнялась с помощью усилителя ЭЭГ Brain Products actiCHamp (Brain Products GmbH, Мюнхен, Германия) и активных электродов. Пять активных электродов (F3, Fz, F4, C3 и C4, система 10-20), встроенные в тот же колпачок, что и оптоды NIRS, использовались для записи сигнала ЭЭГ с частотой дискретизации 2000 Гц относительно вершины. (Чр).Стимулы воспроизводились через два динамика, расположенных на высоте колыбели, примерно в 30 см от головы ребенка с каждой стороны и при уровне звукового давления (УЗД) около 70 дБ.

Пока новорожденные спокойно лежали в своих больничных кроватках, им предъявляли слоги в виде длинных блоков стимуляции (30 с), по шесть блоков на каждое состояние вокодера. Межстимульный интервал между слогами внутри блока варьировался случайным образом от 600 до 1000 мс, а межблочный интервал от 20 до 35 с.Состояние звука «Неповрежденный» всегда воспроизводилось последним, в то время как порядок условий «Медленный» и «Быстрый» был уравновешен для младенцев. Каждый блок содержал 25 слогов, из которых 20 были стандартными (например, / pa /), а 5 — отклоняющимися (например, / ta /), что позволяло оценивать ответы на отдельные слоги внутри блоков, связанные с событиями, аналогично классическому чудаку. или несовпадение дизайна в исследованиях ЭЭГ. Таким образом, каждый блок стимуляции содержал 80: 20% стандартных и девиантных звуков.Первые пять звуков всегда были стандартами, позволяющими сформировать ожидания относительно стандарта. Стандартные и девиантные слоги у младенцев уравновешивались. Весь эксперимент длился около 22 минут.

Анализ данных: fNIRS

Анализы проводились на oxyHb и deoxyHb. Данные подвергались полосовой фильтрации в диапазоне от 0,01 до 0,7 Гц для удаления низкочастотного шума (т. Е. Медленного дрейфа концентраций Hb), а также высокочастотного шума (т. Е. Сердцебиения). Артефакты движения были удалены путем идентификации пар блок-канал, в которых изменение концентрации больше 0.1 ммоль × мм за период 0,2 с и отклонение блока для этого канала. Каналы с достоверными данными для менее трех из шести блоков на одно условие были отброшены. Базовый уровень был установлен с использованием линейной аппроксимации 5-секундного временного окна, предшествующего началу блока, и 5-секундного окна, начинающегося через 15 секунд после окончания блока. 15-секундный период отдыха после смещения стимула использовался, чтобы позволить функции гемодинамического ответа вернуться к исходному уровню. Анализы проводились в MATLAB (версия R2015b) с пользовательскими сценариями анализа.

ROI были определены в соответствии с анализом перестановок. Для кластерного теста перестановки мы использовали тесты t с парными выборками для сравнения каждого состояния вокодера с нулевой базовой линией в каждом канале. Затем все смежные во времени и пространстве пары со значением t , превышающим стандартный порог (мы использовали t = 2), были сгруппированы вместе в кластеры-кандидаты. Мы рассчитали статистику на уровне кластера для каждого кандидата в кластер, суммируя значения t из тестов t для каждой точки данных, включенной в кандидата в кластеры.Затем мы идентифицировали кандидата в кластеры с наибольшим значением t для каждого полушария. Затем анализ перестановок оценил, действительно ли эта статистика на уровне кластера значительно отличается от случайной. Это было сделано путем случайной маркировки данных как принадлежащих к тому или иному экспериментальному условию. Та же самая статистика теста t , что и раньше, была вычислена для каждого случайного распределения, что позволило нам получить ее эмпирическое распределение при нулевой гипотезе об отсутствии разницы между исходным уровнем и каждым условием.Затем кластеры формировались, как и раньше. Доля случайных разделов, которые производят статистику на уровне кластера больше, чем фактически наблюдаемая, дает значение теста P . Всего для этого надежного сравнения было проведено 100 перестановок при нулевой гипотезе.

Аналогичные тесты на перестановки были выполнены для прямого сравнения трех условий, за исключением того, что тест t был заменен односторонним дисперсионным анализом с факторным условием (неповрежденный против быстрого против медленного) и было проведено 1000 перестановок.

Каналы, идентифицированные тестами на перестановку как пространственные кластеры, были включены в линейные модели смешанного эффекта, сравнивающие эффекты фиксированных факторов Условие (Неповрежденный против Быстрого против Медленного), Блок стимуляции (от 1 до 6), Канал и Полушарие (LH против RH), а также случайное влияние Участника на вариации концентрации oxyHb. Сообщается и интерпретируется наиболее подходящая модель.

Электроэнцефалография

Сигнал ЭЭГ подвергался повторной дискретизации при 200 Гц и полосовой фильтрации при 0.От 5 до 20 Гц ( 31 , 32 ). Непрерывные данные ЭЭГ были сегментированы на периоды по 1000 мс, включая 200-мс базовый уровень (от -200 до 0 мс) и привязанные по времени к началу стимула. Эпохи, включающие первый стандартный звук для каждого состояния вокодера и стандарты, следующие непосредственно за девиантными звуками, были исключены, чтобы избежать больших откликов при обнаружении непривычки / новизны. Эпохи с аномальными значениями (<-120 мкВ и> +120 мкВ) затем автоматически исключались. Младенцы были оставлены для анализа данных, если количество девиантных испытаний было не менее 10 в каждом состоянии.Для группы младенцев, включенных в окончательный анализ, среднее количество девиантных эпох, оставшихся для анализа, составляло 28 в интактном состоянии и 27 как в быстром, так и в медленном состоянии.

Для статистических целей мы усреднили вместе все хорошие девиантные эпохи и все хорошие стандартные эпохи в каждом состоянии для каждого младенца в каждом канале. На основе визуального осмотра (см. Рис. S2) амплитуда ЭЭГ, записанная в F3, была усреднена между 300 и 700 мс после начала стимула, чтобы оценить реакцию несоответствия в каждом состоянии.

Благодарности: Мы хотим поблагодарить всех родителей и младенцев, принявших участие в исследовании, а также весь персонал больницы Робер-Дебре, Париж, Франция. Финансирование: Эта работа была поддержана грантом программы Emergence (s) от города Парижа, грантом для молодых исследователей программы Human Frontiers Science (RGY-0073-2014), а также грантом консолидатора ERC «BabyRhythm» (№ 773202) в JG L.C. в настоящее время поддерживается грантом ANR 17-CE28-008. Авторские взносы: Л.К. и Дж. разработал эксперимент. L.C. провел исследование. L.C. и Дж. проанализировали данные. L.C. и Дж. написал газету. Конкурирующие интересы: Авторы заявляют, что у них нет конкурирующих интересов. Доступность данных и материалов: Все данные, необходимые для оценки выводов в статье, представлены в документе и / или дополнительных материалах. Дополнительные данные, относящиеся к этой статье, могут быть запрошены у авторов.

  • Copyright © 2020 Авторы, некоторые права защищены; эксклюзивный лицензиат Американской ассоциации содействия развитию науки.Нет претензий к оригинальным работам правительства США. Распространяется по некоммерческой лицензии Creative Commons Attribution 4.0 (CC BY-NC).

Узор для вязания амигуруми в виде кролика • Просто коллекционное вязание крючком

Кролик амигуруми

Очень простой и быстрый вязаный крючком узор Baby Bunny Amigurumi привнесет весну в любое время года. Поскольку весна действительно начинается (на момент написания этого поста), все с нетерпением ждут полевых цветов, птенцов, солнечного света и легких ливней; но для меня нет ничего важнее весны, чем Пасха.Пасха — это мой личный Новый год, который я встречаю постом, размышлениями и молитвами. А вот с весной так много всего! Вьетнамки, голубые головные уборы, костры, ростки, цветы и кролики — это лишь некоторые из них. 3 года назад у меня была возможность ухаживать за 10 кроликами. Излишне говорить, что они стали отличным удобрением для моего сада. В честь любителей кроликов во всем мире представляю вам выкройку амигуруми Baby Bunny. Одна из этих милашек размером с теннисный мяч работает примерно за 45 минут.Во всяком случае, это мое предположение. Из-за того, что здесь так много прерываний, я никогда не могу точно сказать. (Я говорю это с любовью.)

Материалы:

Super Saver Red Heart — 1 унция.
G-образный крючок / 4,00 мм
Маркер петель
Полифил или обрезок пряжи для заполнения
Глаза амигуруми 8 мм
Ножницы
Игла для пряжи

Сокращения:

sc- одиночное вязание крючком
ftr- основа тройное (тройное) вязание крючком
tr- тройное (тройное) вязание крючком
стежок
петель-
убавление (так же, как 2 вместе / 2 петли, завершенные вместе, чтобы образовать одну петлю) объяснение к follow)
* * — все, что находится между звездочками, является повторяющейся последовательностью.

Нажмите ЗДЕСЬ, чтобы приобрести pdf

Кузов:

R1: 2 петли, 6 сбн во 2-й ряд от крючка
R2: 2 сбн в каждую петлю (12 петель)
R3: * сбн, 2 сбн в следующую петлю * (повторять от * до * — 18 петель)
R4-5: 18 сбн (18 петель)
R6: * 2 сбн, 2 сбн в следующую петлю * (повторять от * до * — 24 петли)
R7: * 3 сбн, 2 сбн в следующую петлю * (повторить от * до * — 30 петель)
R8-14: 30 сбн (30 пет)
R15: 8 сбн вокруг (будет верх спинки), 14 сбн
R16: 22 сбн (22 петли)
Добавить глаза между ряды 4 и 5 или 5 и 6, примерно на 7-8 петель друг от друга.Пришиваем ушки к R8, все в ходу.
R17: 12 дек по кругу, пришейте закрыто, вшейте хвостик, добавьте помпон для хвостика. Чтобы сделать помпон, я оборачиваю пряжу того же цвета вокруг 3 пальцев примерно 25 раз и завязываю их в центре, а затем прорезаю все петли. Затем обрежьте его до чистой формы, которая вам нравится.

Задние лапы:

R1: 2 сбн, 6 сбн во 2-й ряд от крючка
R2: 2 сбн в каждую петлю (12 петель)
R3-5: 12 сбн (12 пет)
R6: * 4 сбн, уб * (10 пет)
Не набивать.
R7-9: 10 сбн (10 петель)
R10: * 3 сбн, уб *, снять петлю, закрепить, оставив длинный хвост для пришивания, пришить к телу, чтобы удерживать кролика.

В качестве подробного руководства по помпонам мне нравится Stitch 11, которое можно найти по адресу: http://stitch21.com/secure-pom-pom-tutorial/

Что касается ушей, то есть два варианта для начала, если вы не работали тройное (тройное) вязание крючком. Чтобы придать ушкам жесткость, я обвязала хвостик крючком. Для меня идеально было начинать с 8-дюймового хвоста, но с еще более длинным хвостом, и вы можете связать его крючком с обеих сторон.Тело и ступни прорабатываются непрерывно.

Уши:

Первый вариант запуска: начиная с ch3, ftr15

Второй вариант начала (альтернатива): ch26, начиная со 2-го ch от крючка tr15 добавить 3tr в последний ch (всего 4 в последнем ch, всего 18st), продолжить работу вокруг противоположной стороны, tr14, hdc в цепочке (15sts- 34st , в том числе нач.ч.) закрепить, оставив длинный хвост пришить.

Пришиваем R8 на голове кролика. Наслаждаться!

Аббревиатуры и символы

Состав:


1.Сокращения в алфавитном порядке


2. Символы схемы вязания крючком


3. Символы уровней навыков



4. Обозначения размера пряжи


1. Сокращения, перечисленные в алфавитном порядке:

begin = start tr tr = тройное тройное вязание крючком
BL = Задняя петля
BP = Задняя стойка
ch chs = цепи
cl = кластер
dc = двойное вязание крючком
dec = уменьшение
dtr = двойное тройное вязание крючком
FO = готовый объект
FP = передняя стойка g

25 грамм
половина постоянного тока = половина двойного вязания крючком
hdc = половина двойного вязания крючком
inc = увеличение
включая = включая
m = метр; также сетка. с) = ряд (и)
сбн = вязание без накида
ск = пропустить
сл. (es)
tog = вместе
tr = тройное вязание крючком / тройное вязание крючком

НЛО = недостроенный объект

YO = пряжа более

* = Шаблон будет указывать, сколько раз повторять последовательность инструкций, следующих за звездочкой или между звездочками.
() = В шаблоне будет указано, сколько раз повторять серию инструкций, которые даны в круглых скобках.
[] = Шаблон будет указывать, сколько раз повторять серию инструкций, указанных в скобках.
“= Дюймы



3. Символы уровней навыков

4. Обозначения размера пряжи

5. Размеры крючка для вязания

Миллиметры U.S. Размер
2,25 мм ………………………… Б-1
2,75 мм ………………………… С-2
3,25 мм ………………………… Д-3
3,5 мм ………………………….. E-4
3,75 мм ………………………… F-5
4мм ……………………………. Г-6
4,5 мм …………………………….. 7
5мм ……………………………. H-8
5,5 мм …………………………… И-9
6мм ……………………………. J-10
6,5 мм ……………………… К-10,5
8мм ……………………………. L-11
9-мм ……………………….. М / Н-13
10мм ……………………….. N / P-15
15-мм ……………………………. P / Q
16мм ………………………………. Q
19мм ……………………………….. S

Вирусы, передаваемые младенцами / основатель ВИЧ-1 в результате послеродовой передачи, устойчивы к нейтрализации парной материнской плазмы

Abstract

Несмотря на обширное генетическое разнообразие ВИЧ-1 при хронической инфекции, один или несколько вариантов материнского вируса становятся причинами инфицирования младенца.Эти передающиеся / основанные (T / F) варианты представляют особый интерес, поскольку вакцина против ВИЧ для матери или ребенка должна вызывать специфические для оболочки (Env) ответы IgG, способные блокировать эту группу вирусов. Однако факторы материнского или младенческого возраста, которые способствуют отбору детских T / F-вирусов, изучены недостаточно. В этом исследовании мы амплифицировали гены ВИЧ-1 env путем амплификации одного генома из 16 передающих пар мать-младенец из исследования передачи инфекции у женщин до антиретровирусной эры в США (WITS).Младенческий T / F и репрезентативные материнские непередаваемые варианты Env из плазмы были идентифицированы и использованы для создания псевдовирусов для анализа чувствительности парной нейтрализации материнской плазмы. Восемнадцать из 21 (85%) детских псевдовирусов T / F Env оказались устойчивыми к нейтрализации парной материнской плазмой. Тем не менее, все детские T / F вирусы были чувствительны к нейтрализации к группе широко нейтрализующих антител ВИЧ-1 и в разной степени чувствительны к гетерологичным антителам, нейтрализующим плазму. Кроме того, эти детские псевдовирусы T / F были в целом более устойчивыми к нейтрализации к парной материнской плазме по сравнению с псевдовирусами от материнских непередаваемых вариантов (p = 0.012). В целом, наши результаты показывают, что аутологичная нейтрализация циркулирующих вирусов антителами материнской плазмы отбирает устойчивые к нейтрализации вирусы, которые инициируют послеродовую передачу, что вызывает предположение, что усиление этой реакции в конце беременности может еще больше снизить риск инфицирования ВИЧ-1 младенцев.

Сведения об авторе

Передача ВИЧ-1 от матери ребенку (ПМР) может происходить во время беременности ( внутриутробно, ), во время родов (в перинатальный период) или при кормлении грудью (в послеродовом периоде).С появлением антиретровирусной терапии (АРТ) частота передачи ВИЧ-1 от матери ребенку значительно снизилась. Однако в регионах с ограниченными ресурсами остаются серьезные проблемы с реализацией, что затрудняет искоренение педиатрической ВИЧ-инфекции. Лучшее понимание вирусной популяции (варианты ускользания от аутологичных нейтрализующих антител), которые приводят к инфицированию младенцев во время передачи, поможет в разработке иммунных вмешательств для снижения перинатальной передачи ВИЧ-1. Здесь мы выбрали 16 ВИЧ-1-инфицированных пар мать-младенец из когорты WITS (до антиретровирусной эры), где младенцы заразились в послеродовом периоде.Последовательности гена env ВИЧ-1 были получены методом амплификации одного генома (SGA). Была проанализирована чувствительность этих детских псевдовирусов Env к парной материнской плазме и панели широко нейтрализующих моноклональных антител (bNAbs). Мы продемонстрировали, что детские T / F-вирусы более устойчивы к материнской плазме, чем непередаваемые материнские варианты, но чувствительны к большинству (bNAbs). Анализ сигнатурных последовательностей младенцев T / F и непередаваемых материнских вариантов выявил потенциальную важность области V3 и MPER для устойчивости к парной материнской плазме.Эти результаты дают представление о разработке стратегий иммунизации матерей для усиления нейтрализующих антител, нацеленных на область V3 популяций аутологичных вирусов, которые могут работать синергетически с АРВ-препаратами матерей для дальнейшего снижения скорости передачи ВИЧ-1 в послеродовом периоде.

Образец цитирования: Kumar A, Smith CEP, Giorgi EE, Eudailey J, Martinez DR, Yusim K, et al. (2018) Вирусы ВИЧ-1, передаваемые младенцами / основатели, в результате послеродовой передачи устойчивы к нейтрализации парной материнской плазмы.PLoS Pathog 14 (4):
e1006944.

https://doi.org/10.1371/journal.ppat.1006944

Редактор: Дэниел К. Дуек, Центр исследования вакцин, США

Поступила: 6 сентября 2017 г .; Одобрена в печать: 16 февраля 2018 г .; Опубликовано: 19 апреля 2018 г.

Это статья в открытом доступе, свободная от всех авторских прав, и ее можно свободно воспроизводить, распространять, передавать, изменять, строить или иным образом использовать в любых законных целях.Работа сделана доступной по лицензии Creative Commons CC0 как общественное достояние.

Доступность данных: последовательностей SGA, сгенерированных для каждой пары мать-ребенок, были депонированы в Genbank под номерами доступа MH012257-MH013187 (http://www.ncbi.nlm.nih.gov/Genbank/).

Финансирование: Эта работа была поддержана Национальным институтом здравоохранения / Национальным институтом аллергии и инфекционных заболеваний (NIH / NIAID), грант 1R01AI22909. Финансирующие организации не играли никакой роли в дизайне исследования, сборе и анализе данных, принятии решения о публикации или подготовке рукописи.

Конкурирующие интересы: Авторы заявили об отсутствии конкурирующих интересов.

Введение

Несмотря на широкий успех антиретровирусной терапии (АРТ) в снижении риска передачи ВИЧ-1 от матери ребенку (ПМР) ниже 2%, ежегодно во всем мире инфицируются более 150 000 детей [1]. Даже если охват АРТ матерей будет достигнут на уровне 90%, ежегодно будет происходить примерно 138 000 случаев инфицирования ВИЧ-1 младенцев [2, 3] из-за факторов, которые включают: несоблюдение режима лечения, прорывные инфекции, развитие штаммов вирусов с лекарственной устойчивостью, позднее проявление беременным женщинам на клиническую помощь, а также при острой инфекции на поздних сроках беременности или кормлении грудью.Передача ВИЧ от матери ребенку может происходить тремя разными способами: дородовой ( внутриутробно), , послеродовой (примерно во время родов) или послеродовой (при грудном вскармливании). Интересно, что только 30–40% младенцев, рожденных от ВИЧ-инфицированных матерей, приобретают ВИЧ-1 в отсутствие АРТ [4]. Таким образом, материнские факторы, такие как материнские Env-специфические антитела, могут способствовать защите младенцев от ВИЧ-инфекции. Материнские факторы, связанные с риском передачи ВИЧ, включают: низкое количество периферических CD4 + Т-клеток у матери и высокую вирусную нагрузку в плазме матери, способ родоразрешения и гестационный возраст младенца [5–7].Тем не менее, роль материнских Env-специфических ответов антител и их связь со снижением риска передачи инфекции от матери ребенку все еще остается неясной. В предыдущих исследованиях сообщалось о связи между величиной ответа материнских антител и снижением риска передачи инфекции от матери ребенку [8–10]. Однако эта связь наблюдается не повсеместно [11–15]. Более того, было замечено, что варианты, передаваемые младенцам, могут быть устойчивыми к нейтрализации материнской плазмой [16], хотя другие исследования не смогли воспроизвести эти наблюдения [17-19].Эти противоречивые результаты могут быть связаны с небольшим количеством субъектов, включенных в эти исследования и дизайн исследований, которые непоследовательно контролируют вирусные факторы и факторы хозяина, которые, как известно, влияют на риск передачи, такие как количество периферических CD4 + Т-лимфоцитов у матери, вирусная нагрузка в плазме, отсутствие идентификации Вирусы T / F и использование АРТ [20, 21]. Более того, аутологичные вирусы из большой когорты ВИЧ-1 инфицированных, передающих матерей, для оценки влияния активности нейтрализации материнской плазмы против ее собственных вирусов, насколько нам известно, не исследовались.Таким образом, несмотря на значительные усилия, остается неясным, влияют ли реакции материнских антител на риск перинатальной передачи ВИЧ.

Мы недавно завершили анализ гуморальных иммунных коррелятов материнской защиты для выявления материнских гуморальных иммунных ответов, связанных с защитой от послеродовой инфекции ВИЧ-1, используя образцы из американского исследования передачи ВИЧ-инфекции у женщин и младенцев (WITS) [22]. Когорта WITS была включена до того, как АРТ стала клиническим стандартом лечения ВИЧ-инфицированных беременных матерей и их младенцев, что исключило сильное влияние АРТ на риск и исход перинатальной передачи ВИЧ-1 [23, 24].Кроме того, мы контролировали установленные факторы риска для матери и ребенка, связанные с перинатальной передачей, включая количество периферических CD4 + Т-лимфоцитов, вирусную нагрузку ВИЧ-1 в плазме матери, гестационный возраст ребенка и способ родоразрешения путем сопоставления оценок предрасположенности передающих и непередающих женщин. . Результаты этого иммунно-коррелятного анализа показали связь между высокими уровнями материнских антител против третьей вариабельной петли гликопротеина Env ВИЧ-1 (V3) и снижением риска ПМР [22].Кроме того, что более удивительно, способность материнской плазмы нейтрализовать вирусы уровня 1 (легко нейтрализовать), но не вирусы уровня 2 (трудно нейтрализовать), также предсказывала снижение риска перинатальной передачи ВИЧ-1. Тем не менее, варианты ВИЧ, передаваемые вертикально, были охарактеризованы как более трудно поддающиеся нейтрализации варианты уровня 2 [17, 25–28]. Таким образом, было удивительно, что нейтрализующие вирус антитела 1-го уровня были связаны со снижением риска передачи. Что еще более интересно, материнские V3-специфические моноклональные IgG-антитела, полученные от матери, не являющейся трансмиссией, нейтрализовали большую часть материнских аутологичных вирусов, полученных из ее плазмы [22], что привело к выводу, что материнские V3-специфические нешироко нейтрализующие антитела, которые были ранее считавшиеся неэффективными для предотвращения передачи ВИЧ-1, действительно могут сыграть роль в предотвращении передачи инфекции от матери ребенку.Фактически, Moody et al [29] показали, что моноклональные антитела, специфичные к сайтам связывания V3 и CD4 (CD4bs), полученные от небеременных хронически инфицированных ВИЧ, могут нейтрализовать большую часть аутологичных циркулирующих вирусов, полученных из плазмы. Эти V3 и CD4bs-специфичные аутологичные вируснейтрализующие mAb проявляли нейтрализующую активность уровня 1, но ограничивали нейтрализацию гетерологичного вируса уровня 2, что позволяет предположить, что измерение эффективности нейтрализации гетерологичного вируса уровня 2 mAb или плазмой не предсказывает способность нейтрализации аутологичного вируса.

В отличие от обширного генетического разнообразия вариантов ВИЧ-1 у хронически инфицированного хозяина, острые ВИЧ-инфекции вызываются ограниченным числом вирусов T / F [17, 18, 30–33]. Это вирусное генетическое узкое место предполагает избирательную передачу одной или однородной группы вирусов [4]. В условиях ПМР иммунологические и вирусологические факторы матери или ребенка, которые стимулируют избирательную передачу одного или нескольких вариантов ВИЧ, не установлены [34]. Поскольку материнские вирусы циркулируют вместе с материнскими Env-специфическими антителами к ВИЧ, вполне возможно, что материнские антитела играют роль в отборе ускользающих вирусов от матери, которые могут инициировать инфекцию у младенца.Следовательно, изучение уникальных свойств детских T / F-вирусов и их детерминант чувствительности к нейтрализации к материнским аутологичным вирусным нейтрализующим антителам может дать представление о молекулярных событиях, которые приводят к ускользанию вируса от материнских гуморальных реакций.

Использование широко нейтрализующих антител в качестве стратегии лечения и / или профилактики в настоящее время изучается в клинических испытаниях взрослых и детей [35, 36]. Среди нового поколения bNAb, VRC01 (антитело, распознающее область CD4bs) смог нейтрализовать около 80% различных штаммов ВИЧ-1 [37, 38].Это привело к исследованиям влияния VRC01 на инфекцию ВИЧ-1 у взрослых и младенцев при пассивной инфузии. В настоящее время проводится фаза I исследования фармакокинетики и безопасности VRC01 у новорожденных, контактировавших с ВИЧ [39]. Однако чувствительность детских T / F-вирусов к bNAb, таким как VRC01, по-видимому, не определяет детские T / F-вирусы от материнских непередаваемых вирусов [17], и введение bNAb хронически инфицированным матерям может привести к быстрому развитию устойчивых вирусов [36, 40].Таким образом, определение роли аутологичной нейтрализации при ПМР имеет решающее значение для установления полезности активной вакцинации матерей для дальнейшего снижения и устранения младенческих ВИЧ-инфекций.

В этом исследовании мы охарактеризовали материнский непередающий и детский T / F вирусы из 16 пар мать-младенец, инфицированных ВИЧ-1 кладой B, из когорты WITS и определили роль одновременных материнских аутологичных нейтрализующих антител в отборе младенцев T / F вирусы. Мы стремились определить, была ли устойчивость к нейтрализации парной материнской плазмой определяющей чертой детских T / F вирусов по сравнению с другими циркулирующими непередаваемыми материнскими вариантами, что послужит основой для разработки стратегий вакцинации матери или ребенка для дальнейшего снижения риска ПМР для достижения Поколение без ВИЧ.

Результаты

Характеристики образцов матери и ребенка

Мы выбрали пары передачи ВИЧ-1 от матери к ребенку из когорты WITS, которые отвечали критериям включения перинатальной передачи (младенцы дали отрицательный результат на инфекцию ВИЧ-1 при рождении с помощью ПЦР ДНК ВИЧ-1, но ДНК ВИЧ-1 обнаруживалась в в возрасте одной недели и старше; Таблица 1). Сообщается, что эти младенцы, контактировавшие с ВИЧ, не находились на грудном вскармливании [24]. Образцы младенческой плазмы, доступные для секвенирования, были в возрасте от 16 до 74 дней.Пять ВИЧ-инфицированных младенцев с гетерогенными вирусными популяциями были исключены из исследования из-за нашей неспособности достоверно сделать вывод о вирусных последовательностях младенцев T / F, и для этого исследования были выбраны в общей сложности 16 пар передачи инфекции от матери к младенцу. Вирусная нагрузка материнской плазмы у выбранных передающих женщин колебалась от 4 104 до 368 471 копий / мл, а количество Т-лимфоцитов CD4 + периферической крови колебалось от 107 до 760 клеток / мм 3 . Вирусная нагрузка в плазме младенцев варьировала от 11 110 до 2 042 124 копий / мл, а количество Т-лимфоцитов CD4 + составляло от 1872 до 7628 клеток / мм 3 .Все младенцы были рождены естественным путем, за исключением трех младенцев (100014, 100155, 100307), родившихся посредством кесарева сечения, что потенциально представляет собой позднюю передачу внутриутробно, . Пять младенцев (100014, 100155, 100307, ​​102149 и 101984) родились преждевременно (31, 34 и 36 неделя соответственно), а остальные младенцы родились между 37 и 40 неделями гестации.

Характеристика полных последовательностей

гена env из парной плазмы матери и ребенка

образцов плазмы младенцев были использованы для получения 465 генных последовательностей env (таблица 2).Соседние филогенетические деревья и графики выделения последовательностей env от каждого младенца были использованы для определения детских T / F вирусов. Эти анализы показали внутриклоновые популяции с низким разнообразием в последовательностях Env младенцев и популяции с высоким разнообразием в материнских последовательностях env (фиг. 1, S1 фиг. И S2 фиг.). У 6 из 16 (37%) новорожденных мы обнаружили 2 или 3 (в случае 100002) генетически различных варианта T / F, один из которых присутствовал с большей частотой (первичный T / F), а остальные — с меньшей частотой. частота (вторичные T / F).У 10 других младенцев (67%) мы наблюдали только один вирус T / F. За исключением двух младенцев, во всех наших выборках было более 20 младенческих последовательностей, что давало нам 90% уверенности в том, что мы смогли выбрать все варианты с популяционной частотой не менее 10%. Для двух выборок младенцев, в которых у нас было только 15 и 18 последовательностей соответственно, мы были на 90% уверены, что смогли выбрать все варианты с популяционной частотой 15% или более [26].

Рис. 1. Графики выделения материнской и младенческой последовательностей env .

Пример пары мать-младенец, где младенец был инфицирован одним вирусом T / F без признаков эволюционного отбора у младенца (3/16 младенцев) (A). Пример матери младенца с признаками эволюционного отбора младенца (B). Пример пары мать-младенец, где младенец был инфицирован двумя разными вирусами T / F (C). Отдельные детские и материнские вирусы представлены на дереве красными точками и синими квадратами соответственно. Цветные решетки на каждом графике маркера представляют собой нуклеотидные различия по сравнению с согласованной последовательностью младенцев вверху и имеют цветовую кодировку в соответствии с нуклеотидом.

https://doi.org/10.1371/journal.ppat.1006944.g001

Всего 463 гена env было получено из 16 образцов материнской плазмы (собранных во время родов) от передающих матерей, как описано ранее [26] . Используя алгоритм, описанный в Методиках, из этих 463 материнских вариантов env мы выбрали 134 варианта SGA для продукции псевдовируса env (5–12 на мать), чтобы представить генетическое разнообразие env , обнаруженное в плазме каждого передающая мать во время родов.

Подтверждение сроков инфицирования младенцев ВИЧ-1

Поскольку младенцы были отобраны для послеродовой передачи, их возраст на момент отбора (в днях) также был временем после заражения. Чтобы подтвердить время инфицирования, все сопоставления младенцев были проанализированы с помощью инструмента LANL Poisson Fitter [41]. Для младенцев, у которых было более одного T / F, для этого анализа использовались только последовательности в основной линии T / F. Когда были обнаружены рекомбинанты и обогащение APOBEC, время рассчитывалось после удаления рекомбинантов и / или положений, обогащенных для гипермутации [26, 41].

После удаления гипермутированных последовательностей и / или рекомбинантов все дети, кроме одного (102605), дали хорошее соответствие Пуассона, что указывает на то, что количество разнообразия, обнаруженное в этих образцах, совместимо со случайным накоплением мутаций, наблюдаемым при острых инфекциях. Время, прошедшее с момента появления наиболее общего предка, соответствовало передаче при родах в 9 из 16 пар (57%) в пределах 95% доверительного интервала оценки времени Пуассона-Фиттера (Таблица 2). Для остальных младенцев расхождения между фактическим ипрогнозируемое время передачи может быть связано с рядом факторов, включая позднюю инфекцию in utero , послеродовую инфекцию в результате несообщаемого грудного вскармливания и модель, предназначенную для оценки эволюции ВИЧ-1 у взрослых, а не у младенцев, которая может быстрее собирать мутации из-за к более устойчивым Т-клеточным ответам.

Infant 102605 env Последовательности SGA не дали хорошего соответствия Пуассона из-за неслучайного накопления несинонимичных мутаций (что нарушает модельное предположение о случайном накоплении мутаций) в положениях HXB2 752–754 (S3 Fig).Согласно базе данных иммунологии LANL (https://www.hiv.lanl.gov/content/immunology/index), в этой области есть пять различных эпитопов CTL человека, что позволяет предположить, что неслучайные мутации, обнаруженные у младенца 102605, были вероятными. из-за давления отбора ответами Т-клеток.

Чувствительность к нейтрализации и классификация детских T / F вирусов

Двадцать один младенец T / F env ампликонов, включая 16 первичных T / F и 5 вторичных T / F, были использованы для создания псевдовирусов и их чувствительности к нейтрализации парной материнской плазмой (собранной во время рождения) и панели bNAb. была оценена.Ни одна из матерей, за исключением двух (100014 и 100504), не имела неспецифической нейтрализующей активности, оцениваемой по нейтрализующей активности против вируса мышиного лейкоза (MLV). Восемнадцать из 21 детского псевдовируса T / F Env (86%) были устойчивы к парной материнской сыворотке (ID 50 <40). Чувствительность 2 детских T / F псевдовирусов (100014 и 100504) к парной материнской плазме не могла быть определена с уверенностью из-за более высокой реактивности плазмы против MLV. Вирус T / F младенца 100046 был чувствителен к парной материнской плазме (рис. 2).

Рис. 2. Уровневое фенотипирование и нейтрализация чувствительности детских псевдовирусов T / F к парной материнской плазме.

Темным цветом обозначены вирусы, которые легко нейтрализовать. Вторые вирусы T / F отмечены звездочками.

https://doi.org/10.1371/journal.ppat.1006944.g002

Когда детские псевдовирусы T / F были протестированы против аутологичной плазмы (плазма от того же ребенка), только 2 T / F (от младенцев 100046 и 100155). ) показал некоторую чувствительность в соответствии с нашими критериями (ID 50 > 3X, чем у MLV), в то время как другие были полностью устойчивы.Некоторые детские псевдовирусы T / F действительно проявляли чувствительность к их собственной плазме, но не считались чувствительными из-за высокой реактивности против MLV (S4, рис.).

Чтобы определить, были ли эти младенческие варианты T / F env глобально устойчивыми к нейтрализации гетерологичной плазмы, мы выполнили фенотипирование уровня нейтрализации с использованием стандартизированной панели гетерологичной плазмы ВИЧ-1 инфицированных лиц [42]. Тринадцать (62%) из 21 детского псевдовируса T / F Env были классифицированы как фенотип нейтрализации 2-го уровня, а 3 (14%) из 21 были классифицированы как фенотип нейтрализации 3-го уровня, как и ожидалось для детских T / F-вирусов (рис. 2).Примечательно, что оставшиеся 5 (24%) протестированных были классифицированы как более легко нейтрализуемые уровни чувствительности уровня 1b или уровня 1а, возможно, потому, что эти варианты были однозначно устойчивыми к их парной материнской плазме (рис. 2).

В отличие от относительной устойчивости к парной нейтрализации материнской плазмы, все детские T / F вирусы были относительно чувствительны к широко нейтрализующим антителам ВИЧ-1 второго поколения, таким как VRC-01 (IC 50 в диапазоне 0,12–5,0 мкг. / мл), PGT121 (IC 50 диапазон 0.01–0,13 мкг / мл), NIH 45–46 (диапазон IC 50 0,01–0,28 мкг / мл) и bNAb 10E8 первого поколения (диапазон IC 50 0,05–0,76 мкг / мл) (Рис. 3 и S5 Рис.) . Неудивительно, что детские псевдовирусы T / F Env были менее чувствительны к нейтрализации к менее мощным широко нейтрализующим антителам первого поколения b12 (IC 50 в диапазоне 2,97-25 мкг / мл), 4E10 (IC 50 в диапазоне 1,31-18,73 мкг / мл). мл) и 2F5 (IC 50 диапазон 1,01–19,09 мкг / мл) (рис. 3). Важно отметить, что все детские T / F вирусы были чувствительны к нейтрализации к VRC-01, bNAb, который в настоящее время оценивается в клинических испытаниях для использования у младенцев, подвергшихся воздействию ВИЧ.Однако гликан-специфические bNAb V3, которые объединяются в кластеры по чувствительности к нейтрализации, и NIh55-46 опосредуют наибольшую широту и эффективность нейтрализации против детских T / F-вирусов (рис. 3).

Рис. 3. Нейтрализационная чувствительность детских T / F псевдовирусов к панели bNAb.

Мощность ответов обозначена цветом от темного к светлому, где более темные цвета указывают на более сильные ответы. Оттенки красного используются для реакции младенца, оттенки зеленого — для потенции, а оттенки синего — для широты (% нейтрализации).Серые поля указывают на отсутствие ответа. Эффективность (среднее геометрическое количество ответов) и широта (% нейтрализации) детских вирусов на каждый bNAb сравнивали со средними геометрическими значениями активности и широты bNAb, полученными из опубликованных исследований с использованием репозитория LANL CATNAP (столбцы справа). Наиболее эффективная нейтрализация против детских вирусов была опосредована гликановыми bNAbs V3 и сайтом связывания CD4 NIh55-46.

https://doi.org/10.1371/journal.ppat.1006944.g003

Затем мы вычислили геометрические средние как ширины, так и эффективности панели bNAb против детских T / F вирусов и сравнили с их эффективностью против других вариантов ВИЧ, как указано в CATNAP (Compile, Analyze and Tally NAb Panels ) [43], интерфейс Лос-Аламосской национальной лаборатории (LANL), который собирает все опубликованные иммунологические данные. В целом, эффективность и широта bNAb против детских T / F-вирусов соответствовали средней активности и широте, рассчитанным в CATNAP (p = 0.013 и 0,02 соответственно, корреляционный тест Спирмена), за одним исключением: bNAb 2G12 показал более сильные и широкие ответы у младенцев, чем в коллективных данных CATNAP (рис. 3).

Чувствительность к нейтрализации непередаваемых от матери

вариантов env по сравнению с младенческими вариантами T / F env вариантов

Псевдовирусы были приготовлены из 134 непередаваемых материнских вариантов env с использованием метода промоторной ПЦР [44] и оценены на чувствительность нейтрализации против парной материнской плазмы, включая непередаваемый от матери вариант, который был наиболее тесно связан с младенцем Вариант T / F.Различная чувствительность к нейтрализации парной материнской плазмы наблюдалась в непередаваемых материнских вариантах, при этом некоторые из вариантов проявляли чувствительность к нейтрализации, а другие демонстрировали полную устойчивость к нейтрализации (рис. 4). Сравнение чувствительности к нейтрализации между младенческими вариантами T / F Env и идентифицированным ближайшим материнским вариантом в каждой паре мать-младенец не выявило последовательной закономерности. Более чем 2-кратное увеличение чувствительности наблюдалось для псевдовирусов Env непередаваемых материнских вариантов, которые были наиболее тесно связаны с младенческим T / F для 6 младенцев (100002, 100307, ​​100052, 102149, 102407 и 102605).Напротив, детские псевдовирусы T / F Env от 3 младенцев (100014, 100046 и 100504) были более чувствительны к материнской плазме, чем их наиболее близкие материнские варианты.

Рис. 4. Чувствительность к нейтрализации непередаваемых материнских вариантов и детских псевдовирусов T / F к парной материнской плазме.

(A) Чувствительность к нейтрализации детских T / F вирусов сравнивалась с непередаваемыми материнскими вирусами для каждой пары мать-ребенок, и (B) чувствительность к нейтрализации сравнивалась между всеми детскими вирусами T / F и всеми непередаваемыми материнскими вариантами вместе.Варианты, не передаваемые от матери, показаны черными точками, а детские T / F-вирусы представлены синими треугольниками (1-й T / F) и синими точками (2-й T / F). Последовательности материнских вариантов были отобраны в соответствии с алгоритмом для представления различных мотивов, которые расходятся с T / F младенца (см. Методы). Черные горизонтальные линии представляют собой медианное значение ID 50 материнских и младенческих последовательностей. Значение P было определено с помощью одностороннего перестановочного теста.

https://doi.org/10.1371 / journal.ppat.1006944.g004

Тем не менее, детские T / F-вирусы, как правило, были более устойчивы к материнской плазме при родах, чем непередаваемые вирусы от матерей в каждой паре мать-ребенок, за исключением 100046. Однако, поскольку у каждого младенца было только 1 или 2 вируса T / F, мы не смогли провести статистический анализ, чтобы определить, были ли различия статистически значимыми в каждой паре. Чтобы определить, были ли детские T / F-вирусы в целом более устойчивыми к материнской плазме, чем парные непередаваемые материнские вирусы, мы использовали односторонний пермутационный тест для сравнения чувствительности нейтрализации непередаваемых от матери вариантов к T / F Env ребенка варианты.Примечательно, что детские варианты T / F Env в целом были значительно более устойчивыми к парной материнской плазме, собранной при родах, чем непередаваемые материнские варианты Env (p = 0,012). Даже если исключить пары мать-младенец с высокой нейтрализацией MLV (100014 и 100504), детские варианты T / F Env оставались более устойчивыми к нейтрализации, чем непередаваемые материнские варианты (p = 0,005).

Чтобы оценить, отличается ли какая-либо конкретная эпитоп-специфическая чувствительность к нейтрализации у младенцев T / F по сравнению с подобранными материнскими вариантами, мы определили нейтрализационную чувствительность 4 bNAbs, нацеленных на отдельные уязвимые эпитопы на Env: VRC-01 ВИЧ-1 (CD4bs-специфичные). , PG9 (специфичный для гликана V2), Dh529 (специфичный для гликана V3) и DH512 (проксимальный внешний участок мембраны — специфичный для MPER) (фиг. 5 и S6, фиг.).Мы использовали тот же тест односторонней перестановки, описанный выше, для оценки различий в чувствительности нейтрализации к этим bNAb в младенческих T / F по сравнению с непередаваемыми материнскими последовательностями. Интересно, что мы обнаружили, что детские T / F-вирусы были значительно более устойчивы к DH512 (MPER-специфическим) по сравнению с непередаваемыми материнскими последовательностями (p = 0,025 по одностороннему критерию перестановки; p = 0,045 при исключении двух матерей с неинтегрированными генами). специфическая нейтрализация), в то время как все другие сравнения не дали статистической значимости (Фиг.5 и S6 Фиг).

Рис. 5. Нейтрализационная чувствительность материнских и младенческих вирусов к bNAbs DH512 и VRC-01.

IC 50 был определен для вариантов, не передаваемых от матери (черные точки), и детских вариантов T / F (треугольники и круги синего цвета), нейтрализованных VRC-01 и DH512. Черные горизонтальные линии представляют собой медианное значение IC 50 bNAbs. Пунктирные линии представляют самую высокую концентрацию Ab (5 мкг / мл), использованную в эксперименте.

https: // doi.org / 10.1371 / journal.ppat.1006944.g005

Анализ сигнатурной последовательности вариантов T / F младенцев для прогнозирования устойчивости к нейтрализации

Поскольку DH512 связывается с областью MPER, мы исследовали положения аминокислот в этом эпитопе (положения 662–683) и идентифицировали 4 положения, которые либо были связаны с более высокой нейтрализацией материнской плазмы ID 50 (в положении 662, аминокислота A, K, Q или S были значительно более устойчивыми, чем дикий тип E, p = 9.9e-05, односторонний тест перестановки), более низкий DH512 IC 50 (в положениях 667 и 676, p = 9.9e-04 и 0,003, соответственно, с помощью теста односторонней перестановки), или того и другого (в положении 683 аминокислота R была значительно более устойчивой, чем аминокислота K дикого типа, наиболее часто встречающаяся AA в этом положении, p <1e-04 на 1- Тест двусторонней перестановки (рис. 6). Чтобы понять роль аминокислот в положениях 662 и 683 в устойчивости детских T / F вирусов против материнской плазмы, были созданы два мутанта gp41 R683K и Q662E для генов env 100997i и 102407i T / F соответственно Для мутанта R683K 100997i не наблюдалось влияния на чувствительность к нейтрализации, тогда как мутант Q662E 102407i T / F был более чувствителен к парной материнской плазме, чем вирус дикого типа (S7 фиг.).

Рис. 6. Сравнение нейтрализационной чувствительности материнского и младенческого вирусов к DH512.

Сравнение парных непередаваемых последовательностей материнской плазмы и MPER bNAb DH512 материнских непередаваемых последовательностей (черные точки) и младенческих последовательностей T / F (синие треугольники) между последовательностями, которые несут аминокислоту дикого типа в положениях HXB2 662, 676, 676 и 683 по сравнению с мутантами. Эти четыре позиции были выбраны, потому что они дали значительную связь с ответами материнской плазмы (т.е. последовательности, несущие мутант, были статистически значимо более устойчивыми к материнской плазме) или с ответами DH512 (т.е. последовательности, несущие мутант, были статистически значимо более устойчивы к DH 512) в эпитопе MPER. P-значения были получены с использованием теста односторонней перестановки (см. Методы). Серые прямоугольники представляют собой медиану и квартили ответов.

https://doi.org/10.1371/journal.ppat.1006944.g006

Однако, когда мы посмотрели на последовательности Env в отдельных парах мать-младенец, эти аминокислотные остатки, которые связаны с устойчивостью к нейтрализации DH512, были одинаково распределены среди других -передаваемые материнские последовательности и детские T / F вирусы.Следовательно, мы не смогли определить, были ли вирусы T / F, несущие указанные выше придающие устойчивость аминокислотам, более склонными к передаче по сравнению с непередаваемыми материнскими вариантами. Это может быть связано с низким порядковым номером в парах или предполагает, что аминокислоты дикого типа в этих положениях связаны с устойчивостью к нейтрализации DH512, но не обязательно с передачей. Однако детские T / F вирусы и материнские варианты, которые имеют одинаковую последовательность в области MPER, могут иметь более чем трехкратные различия в нейтрализации DH512 MPER-ассоциированных антител, что указывает на наличие остатков во фланкирующих областях, которые влияют на MPER-ассоциированную нейтрализацию.

Анализ аминокислотной сигнатуры петли V3 и чувствительность к нейтрализации парной материнской плазмой

Поскольку материнское связывание V3-специфического IgG и нейтрализующие ответы вируса 1-го уровня предсказывали риск передачи инфекции от матери ребенку в этой когорте [22], мы исследовали возможные признаки устойчивости к нейтрализации парной материнской плазмы в области V3. Мы исследовали сильно вариабельные аминокислотные остатки N- и C-концевой области K305Q, I307T, h408T, R315Q, F317L, A319T и D322R (рис. 7), 3 из которых (K305Q, I307T и h408T) ранее были идентифицированы как критические мишени. V3-специфических ответов IgG, связанных со снижением риска передачи инфекции от матери ребенку [45].Сравнивая непередаваемые материнские последовательности и детские T / F вирусы, мы обнаружили, что положение K305R значительно связано с более высокой чувствительностью к парной материнской плазме (p <0,001 по одностороннему критерию перестановки). В положении 308 последовательности, несущие мутации консенсусной аминокислоты H (N, P, S или T), были значительно связаны с более высокой устойчивостью к нейтрализации парной материнской плазмы (p <0,001 по результатам теста односторонней перестановки). Это несоответствие может частично быть связано с гетерогенностью в положении 308 аминокислотного остатка.Тем не менее, 6 из 14 передающих пар мать-младенец демонстрировали отличные аминокислотные остатки в положении 308 от более часто встречающегося гистидина (фиг. 7), предполагая, что вариабельность в этом положении может быть чрезмерно представлена ​​в передающих парах. Однако, что касается остатков MPER, мы наблюдали, что эти аминокислоты были одинаково распределены по последовательностям непередаваемого материнского и младенческого вируса T / F, что указывает на то, что ни один из этих аминокислотных остатков не был напрямую связан с риском передачи.

Рис. 7. Частотный график последовательностей области V3 вирусов T / F матери и ребенка.

График Weblogo, показывающий частоту аминокислот в области V3, был построен с использованием инструмента AnalyzAlign с веб-сайта LANL. Позиции были пронумерованы на основе аминокислотной последовательности HXB2. Позиции аминокислот, идентифицированные при анализе сигнатурной последовательности, отмечены вверху графика.

https://doi.org/10.1371/journal.ppat.1006944.g007

Обсуждение

В то время как АРТ у матерей и младенцев значительно снизила показатели ПМР, детская ВИЧ-инфекция остается серьезной проблемой общественного здравоохранения в регионах с высокой распространенностью ВИЧ, при этом до 16% ВИЧ-инфицированных женщин по-прежнему передают вирус своим младенцам во всем мире [1].Вполне вероятно, что для элиминации ВИЧ у детей потребуется вакцина против ВИЧ-1 матери или ребенка [46]. Однако для разработки стратегий вакцинации, которые могут блокировать передачу ВИЧ-1, потребуется лучшее понимание факторов, влияющих на передачу ВИЧ-1 в условиях ПМР. Недавние результаты, опубликованные нашей группой, показали, что ответные реакции материнских V3-петлевых и вирус-нейтрализующих антител 1 уровня коррелировали и были независимо связаны со снижением риска ПМР. Более того, мы установили, что V3-специфические антитела в материнской плазме могут нейтрализовать материнские аутологичные вирусные варианты, циркулирующие в плазме [22, 29].Чтобы изучить потенциальную роль материнских Env-специфических ответов Ab в создании вирусного генетического узкого места ПМР, мы стремились определить, является ли устойчивость к нейтрализации материнских аутологичных вирусных нейтрализующих антител определяющей характеристикой детских T / F-вирусов по сравнению с циркулирующими материнскими не-вирусами варианты передаваемой плазмы.

Хотя последовательности гена env , полученные из одних и тех же вирусов T / F, были очень гомогенными у всех младенцев, мы наблюдали эволюционный отбор в некоторых последовательностях env младенцев , на что указывает присутствие одинаковых несинонимичных мутаций во множестве env последовательности генов (рис. 1В).Шесть из 16 (37%) новорожденных, инфицированных в послеродовом периоде, были инфицированы как минимум 2 вирусами T / F. Инфекция множественными T / F-вирусами встречается примерно в 19–24% случаев гетеросексуальных ВИЧ-инфекций [26, 47, 48] и 12–38% случаев гомосексуальных инфекций [49–51], тогда как до 60% инфекций происходят через внутривенное употребление наркотиков связано с множественными Т / Ф [52]. Таким образом, частота множественных передач T / F в этой когорте мать-младенец соответствует способам передачи половым путем или немного выше, чем при внутривенном употреблении наркотиков.Хотя хорошо известно, что генетическое «узкое место» возникает при ПМР, детерминанты, которые определяют выбор одного или нескольких вирусов T / F, менее ясны [4]. Важно отметить, что отсутствие профилактики АРТ у матерей во время родов в когорте WITS могло способствовать наблюдаемому высокому уровню множественных вирусов T / F, потенциально происходящих из-за более крупного вирусного инокулята в этой когорте по сравнению с матерями, получавшими АРВ-терапию. Примечательно, что эти детские T / F-вирусы всегда представляли минорный вариант вариантов Env материнской вирусной популяции, что указывает на то, что материнские антитела, которые могут блокировать передачу вируса младенцам, должны будут нацеливаться на второстепенные циркулирующие варианты.

Более глубокое понимание вирусологических характеристик детских T / F-вирусов также будет иметь важное значение для разработки иммунных стратегий предотвращения передачи инфекции от матери ребенку. Анализ нейтрализации BNAb всех детских T / F вирусов показал, что они были значительно более устойчивы к DH512 (антитела, специфичные для области MPER), чем непередаваемые материнские варианты, мы исследовали роль нейтрализующих антител на основе области MPER материнской плазмы в эволюции детских T / F [53]. Анализ сигнатурных последовательностей последовательностей MPER показал, что E662 и K683 были связаны с чувствительностью детских T / F-вирусов к материнской плазме.Анализировали сайт-направленный мутагенез в области MPER двух младенцев T / F env генов из 100997i R683K и 102407i Q662E и тестировали чувствительность к парной материнской плазме. Результаты показали, что идентифицированные остатки в эпитопе области MPER действительно играли роль в ускользании младенческих вирусов T / F для одного детского T / F (102407i), но не для другого вируса T / F (100997i). Однако нельзя исключать роль других регионов или структур в распознавании этого эпитопа MPER. Этот результат подтверждает наш анализ сигнатурных последовательностей, а также указывает на потенциальную важность других областей Env в ускользании младенческих T / F-вирусов от давления отбора материнской плазмы.

Поскольку материнские V3-специфические IgG-ответы предсказывали снижение риска передачи в этой когорте, мы исследовали остатки петли V3 в материнских и младенческих вирусах и их связь с парной чувствительностью к нейтрализации материнской плазмы. Несмотря на связь между материнскими V3-специфическими ответами IgG, направленными на С-концевую область, и снижением риска ПМР в этой когорте [45], мы не обнаружили, что аминокислотные остатки в С-концевой области связаны с устойчивостью к нейтрализации парной материнской плазмы.Вместо этого мы обнаружили, что материнские непередаваемые вирусы и детские T / F вирусы, несущие N, P, S или T в положении 308 аминокислотного остатка N-концевой области, были более устойчивыми к нейтрализации к парной материнской плазме. Эти, казалось бы, несопоставимые результаты частично можно объяснить несколькими причинами. Во-первых, было показано, что N-концевые аминокислотные остатки 308 и 309 взаимодействуют с C-концевым аминокислотным остатком 317, и это взаимодействие приводит к стабилизации петли V3 [54, 55]. Таким образом, нарушение внутрипептидных взаимодействий либо в N-, либо в C-концевой области может приводить к измененной нейтрализационной чувствительности вирусов к парным материнским V3-специфическим плазменным ответам IgG.Во-вторых, следует отметить, что в этом исследовании мы сравнивали материнские непередаваемые циркулирующие вирусы с младенческими T / F-вирусами в 16 передающих парах мать-младенец, тогда как ранее мы определили потенциально защитную роль материнского V3-специфического связывания IgG и нейтрализации. ответы путем сравнения передающих и непередающих женщин в большем количестве (n = 248) субъектов в когорте WITS [22, 45]. Следовательно, могут быть различия в тонкой специфичности и нейтрализующей функции V3-специфических ответов IgG у этих 16 матерей, передающих беременность, по сравнению с n = 165 женщинами, не передающими инфекцию, из когорты WITS.Кроме того, могут быть различия в доступности петли V3 у этих 16 передающих матерей по сравнению с непередающими женщинами в этой когорте, что объясняет отсутствие сигнатуры аминокислотных остатков петли V3, которая связана с устойчивостью к нейтрализации. Предыдущая работа показала, что доступность петли V3 для материнских нейтрализующих антител может модулироваться дистальными аминокислотными остатками внутри gp120 или gp41 [15]. Например, специфические сайты гликозилирования внутри петли V1 могут изменять доступность петли V3 для V3-специфических нейтрализующих антител [56].Более того, взаимодействия между C2 и V3 могут стабилизировать структуру Env ВИЧ-1 [57], как продемонстрировано недавним выяснением кристаллической структуры тримера SOSIP [58].

В отличие от предыдущих исследований, в которых изучалась чувствительность к нейтрализации случайно выбранных или непарных детских или материнских вирусов, здесь мы определили чувствительность к нейтрализации парных детских T / F-вирусов и непередаваемых от матери вариантов. Более того, в этом исследовании учитывались филогенетические взаимоотношения детских T / F-вирусов и материнских непередаваемых вариантов, чтобы представить различные фонды материнских вирусов.Кроме того, мы тщательно контролировали наличие искажающих факторов, таких как способ передачи и несопоставимые исследования образцов матери и ребенка. Более того, поскольку когорта WITS была включена и наблюдалась до появления АРТ для предотвращения передачи инфекции от матери ребенку, вирусная эволюция в этой когорте не зависит от давления выбора АРТ. С помощью этого надежного дизайна исследования наш анализ продемонстрировал, что детские T / F вирусы в основном устойчивы к параллельной материнской плазме, что позволяет предположить, что детские T / F вирусы определяются устойчивостью к нейтрализации парных материнских нейтрализующих антител.Эта работа подтверждает предыдущие исследования, которые сделали этот прогноз на основе небольших исследований или с менее четко определенными материнскими и младенческими вариантами вирусов [16, 59, 60]. Тем не менее, Милиган и . и [61] недавно показали, что вирусы, устойчивые к нейтрализации, не предсказывают риск передачи инфекции от матери ребенку в условиях кормления грудью. Однако, поскольку наш анализ был сосредоточен на передаче ВИЧ в послеродовом периоде, могут быть разные вирусологические или иммунологические детерминанты передачи ВИЧ в послеродовом и послеродовом периоде.Тем не менее, важное и новое наблюдение, сделанное в этом исследовании, заключается в том, что устойчивость к нейтрализации детских T / F-вирусов материнской плазмой не является предиктором устойчивости к нейтрализации гетерологичной плазмой. Примечательно, что многоуровневая категоризация детских T / F-вирусов варьировалась от легко нейтрализуемых вирусов уровня 1a до очень сложных для нейтрализации вирусов уровня 3, что позволяет предположить, что гетерологичная устойчивость к нейтрализации плазмы не является определяющей характеристикой детских T / F вирусов. В частности, 24% детских T / F вирусов, охарактеризованных в этом исследовании, были классифицированы как варианты уровня 1b или уровня 1a стандартной панелью гетерологичной плазмы [42], что согласуется с гипотезой о том, что эти детские T / F вирусы могут быть специфически устойчивыми к материнские антитела, которые эволюционировали вместе с переданными вариантами.

Большинство детских T / F-вирусов были чувствительны к нейтрализации ряда широко нейтрализующих антител второго поколения (рис. 5). Клинические исследования по анализу безопасности и фармакокинетической способности VRC01 показали, что он хорошо переносится [40]. Кроме того, VRC01 был способен защищать нечеловеческих приматов от инфекции [62, 63]. Наши результаты клинически значимы, поскольку они предполагают, что пассивная иммунизация младенцев широкими и мощными bNAb второго поколения для предотвращения передачи ВИЧ-1 может быть эффективной стратегией для блокирования передачи инфекции от матери ребенку.Единая чувствительность этих недавно охарактеризованных детских T / F вирусов клады B к нейтрализации VRC01 указывает на то, что эти вирусы будут эффективно нейтрализованы VRC01 и что передача младенческого вируса клады B может быть заблокирована VRC01. Интересно, что в настоящее время проводятся клинические испытания пассивной иммунизации новорожденных из группы высокого риска, контактировавшие с ВИЧ, с помощью VRC01 (https://clinicaltrials.gov/ct2/show/record/NCT02256631).

Насколько нам известно, это крупнейшее исследование, в котором были охарактеризованы детские T / F и материнские вирусы и их нейтрализационная чувствительность к нейтрализующим ответам матери.В нашем исследовании конкретно рассматривается вопрос о том, определяются ли детские T / F-вирусы по их чувствительности к нейтрализации материнских аутологичных вирусных нейтрализующих антител при послеродовой передаче ВИЧ от матери ребенку.

ПМР — это уникальная среда, в которой защитные антитела должны блокировать только аутологичные вирусные варианты, циркулирующие в крови, воздействию которой подвергается младенец. Наблюдение, что детские T / F-вирусы устойчивы к нейтрализации по сравнению с непередаваемыми материнскими вариантами, предполагает, что разработка материнской вакцины, которая усиливает нейтрализующие реакции материнского аутологичного вируса, может быть жизнеспособной стратегией для дальнейшего снижения риска ПМР.Схемы иммунизации материнского Env с близкородственными, но не идентичными Env популяциям материнского циркулирующего вируса могут вызывать выработку антител, которые нацелены на пул материнского аутологичного вируса посредством хорошо описанного иммунного феномена «исходного антигенного греха» [64, 65]. Наш центральный вывод о том, что устойчивость к нейтрализации материнской плазмы чаще встречается у детских T / F-вирусов, чем у непередаваемых материнских вирусов, имеет важное значение для разработки стратегий вакцинации Env матерей, которые могут улучшить нейтрализацию материнского аутологичного вируса и синергетически с текущими стратегиями лечения АРТ, помогающими снизить скорость перинатальной передачи вируса.

Материалы и методы

Объекты исследования и сбор образцов

Были отобраны

пар матери и ребенка из когорты WITS, которые соответствовали следующим критериям: перипартальная передача, образцы плазмы младенцев в возрасте <2,5 месяцев и образцы матери, доступные сразу после родов. Перипартальная передача определялась отрицательным результатом ПЦР или отрицательным посевом из образцов периферической крови, собранных в течение 7 дней после рождения, с последующим положительным результатом через 7 дней после рождения (Таблица 1).

Заявление об этике

Образцы, использованные в этом исследовании, были получены из существующей когорты, названной «Исследование передачи инфекции у женщин-младенцев» (WITS). Когортные образцы WITS были получены как неидентифицированный материал и были сочтены исследовательским советом Duke University Institutional Review Board (IRB) как исследование без участия человека. Номер ссылки для этого протокола и определения — Pro00016627.

Экстракция вирусной РНК и анализ SGA

Вирусная РНК была очищена из образца плазмы от каждого пациента с помощью мини-набора для вирусной РНК Qiagen QiaAmp и подвергнута синтезу кДНК с использованием 1X реакционного буфера, 0.5 мМ каждого дезоксинуклеозидтрифосфата (dNTP), 5 мМ DTT, 2 ед. / Мл RNaseOUT, 10 ед. / Мл смеси для обратной транскрипции SuperScript III (Invitrogen) и 0,25 мМ антисмыслового праймера 1.R3.B3R (5′-ACTACTTGAAGCACTCAAGGCAAGCT TTATTG -3 ‘), расположенный в открытой рамке считывания nef . Полученную кДНК разводили до конечной точки в 96-луночных планшетах (Applied Biosystems, Inc.) и амплифицировали с помощью ПЦР с использованием ДНК-полимеразы Platinum Taq High Fidelity (Invitrogen) так, чтобы <30% реакций были положительными, чтобы максимизировать вероятность амплификации от единый геном.Второй цикл амплификации ПЦР проводили с использованием 2 мкл продуктов первого цикла в качестве матрицы. 07For7 (5'-AAATTAYAAAAATTCAAAATTTTCGGGTTTATTACAG-3 ') и 2.R3.B6R (5'-TGA AGCACTCAAGGCAAGCTTTATTGAGGC -3') использовали в качестве пары праймеров в первом раунде ПЦР-амплификации (с последующим этапом 5 праймеров VIF '- GGGTTTATTACAGGGACAGCAGAG -3') (нуклеотиды 5960–5983 в кодирующей области tat HXB2) и Low2c (5'-TGAGGCT TAAGCAGTGGGTT CC -3 ') (нуклеотиды 9413–9436 в nef HXB2). ПЦР проводили с использованием 1X буфера, 2 мМ MgSO4, 0.2 мМ каждого dNTP, 0,2 мкМ каждого праймера и 0,025 ед. / Мкл полимеразы Platinum Taq High Fidelity (Invitrogen) в 20 мкл реакционной смеси. Условиями амплификации 1 раунда были 1 цикл при 94 ° C в течение 2 минут, 35 циклов при 94 ° C в течение 15 секунд, 58 ° C в течение 30 секунд и 68 ° C в течение 4 минут, а затем 1 цикл при 68 ° C в течение 10 секунд. минут. Условия раунда 2: один цикл 94 ° C в течение 2 минут, 45 циклов 94 ° C в течение 15 секунд, 58 ° C в течение 30 секунд и 68 ° C в течение 4 минут, а затем 1 цикл при 68 ° C в течение 10 минут. . Ампликоны ПЦР в раунде 2 визуализировали электрофорезом в агарозном геле и секвенировали в отношении гена оболочки с использованием генетического анализатора ABI3730xl (Applied Biosystems).Конечный продукт амплификации 3’-половины генома составлял ~ 4160 нуклеотидов в длину, исключая последовательности праймеров, и включал все из rev и env gp160, а также 336 нуклеотидов из nef . Частично перекрывающиеся последовательности из каждого ампликона собирали и редактировали с помощью Sequencher (Gene Codes, Inc). Последовательности с двойными пиками на считывание оснований отбрасывали. Последовательности с одним двойным пиком были сохранены, поскольку это, скорее всего, представляет ошибку полимеразы Taq в раннем раунде ПЦР, а не множественной амплификации матрицы; такие неоднозначности последовательности считались консенсусным нуклеотидом.Выравнивания последовательностей и филогенетические деревья были построены с использованием ClustalW, а графики Highlighter были созданы с использованием инструмента по адресу https://www.hiv.lanl.gov/content/sequence/HIGHLIGHT/highlighter_top.html.

последовательности SGA, созданные для каждой пары мать-ребенок, были депонированы в Genbank под номерами доступа MH012257-MH013187 (http://www.ncbi.nlm.nih.gov/Genbank/).

Выравнивание последовательностей

Все последовательности оболочки матери и ребенка были выровнены с помощью инструмента Gene Cutter, доступного на веб-сайте Лос-Аламосской национальной лаборатории (LANL) (http: // www.hiv.lanl.gov/content/sequence/GENE_CUTTER/cutter.html), а затем уточнял вручную. Последовательности полноразмерных конвертов вручную редактировались в Seaview [66]. Последовательности младенческого вируса T / F env были идентифицированы путем анализа филогенетических деревьев и графиков выделения, а младенческие консенсусные последовательности основной линии T / F были сгенерированы с использованием инструмента LANL Consensus Maker (http://www.hiv.lanl.gov/ content / sequence / CONSENSUS / consnsus.html). Для младенцев, которые были инфицированы 2 или более различными вирусами T / F, графики выделения и филогенетические деревья основывались на консенсусе основного варианта.

Вывод младенческого T / F

env последовательностей

Выравнивание материнской и младенческой оболочек было охарактеризовано с использованием филогении Bio-NJ (программное обеспечение Mega 6) и графика выделения. Количество детских T / F-вирусов определяли визуальным осмотром филогенетических деревьев и графиков выравнивания последовательностей младенцев и матери env . Гипермутацию также оценивали с помощью инструмента Hypermut (http://www.hiv.lanl.gov/content/sequence/HYPERMUT/hypermut.html).Последовательности со значительной гипермутацией (p <0,1) были удалены из выравнивания и не включены в дальнейший анализ. Когда было обнаружено, что образец в целом обогащен для гипермутации [26], позиции в контексте сигнатуры APOBEC были удалены (Таблица 2). Все 16 младенческих инфекций были острыми, и мы смогли определить время инфицирования с помощью метода Пуассона-Фиттера после удаления предполагаемых рекомбинантов и / или гипермутированных последовательностей, как описано выше. Количество дней, прошедших с момента инфицирования младенца, рассчитывали с помощью инструмента Poisson Fitter (http: // www.hiv.lanl.gov/content/sequence/POISSON_FITTER/ pfitter.html), который оценивает время с момента заражения на основе накопления случайных мутаций от самого последнего общего предка (MRCA) [41]. Для младенцев, инфицированных 2 или более вирусами T / F, анализировали только основной вариант, чтобы определить время, прошедшее с момента заражения. Определенная частота мутаций составила 2,16e-5. Значения были представлены в днях с 95% доверительным интервалом и p-значением согласия.

Клонирование младенцев T / F

env Последовательности SGA

ампликонов из продукта ПЦР первого раунда, которые соответствовали консенсусной последовательности младенца (последовательность вируса T / F), лигировали в pcDNA3.1 Направленные векторы Topo (Invitrogen) путем введения -CACC 5 ’конца посредством реакции ПЦР с праймерами Rev19 (5’-ACTTTTTGACCACTTGCCACCCAT-3’) и Env1A (5’-caccTTAGGCATCTCCT ATGGCAGGAAGAAG-3 ’). Мастер-смесь Phusion High-Fidelity PCR Master Mix с HF-буфером использовали в соответствии с инструкциями производителя (New England BioLabs). Затем плазмиды трансформировали в химически компетентные клетки Escherichia coli XL10 gold. Культуры выращивали при 37 ° C в течение 16 часов. Колонии отбирали для роста, плазмиды подвергали минипрепарации, а качество контролировали расщеплением рестрикционными ферментами с использованием BamHI и XhoI (New England BioLabs).Плазмиды, содержащие вставку правильного размера, секвенировали для подтверждения 100% гомологии последовательности с исходной консенсусной последовательностью env infant. Затем с помощью набора Megaprep (Qiagen) получали плазмиды и повторно секвенировали для подтверждения. Для трех младенцев, 100046, 100383 и 101580, ни одна из последовательностей SGA не соответствовала 100% нуклеотидов в консенсусной последовательности. Поэтому был проведен сайт-направленный мутагенез одного нуклеотида для создания гена env , идентичного консенсусной последовательности. Праймеры для сайт-направленного мутагенеза были сконструированы с использованием программы создания праймеров Agilent QuikChange и использовался набор Agilent QuikChange II XL.Секвенирование клонов было выполнено для обеспечения 100% гомологии с консенсусной последовательностью младенцев.

Препарат псевдовирусов

Псевдовирусы Env

получали путем трансфекции в клетки HEK293T (ATCC, Manassas, VA) 4 мкг плазмидной ДНК env и 4 мкг env-дефицитной плазмидной ДНК ВИЧ (SG3Δenv) с использованием реагента для трансфекции FuGene 6 (Roche Diagnostics) в колбе T75. Через два дня после трансфекции супернатант культуры, содержащий псевдовирусы, собирали, фильтровали, разделяли на аликвоты и хранили при -80 ° C.Аликвоту замороженного псевдовируса использовали для измерения инфекционности в клетках TZM-bl. 20 мкл псевдовируса распределяли в двух экземплярах на 96-луночные планшеты с плоским дном (Co-star). Затем добавляли свежеприготовленные трипсинизированные клетки TZM-bl (10000 клеток / лунку в среде Игла, модифицированной Дульбекко (DMEM) -10% фетальной бычьей сыворотки (FBS), содержащей HEPES и 10 мкг / мл DEAE-декстрана). После 48 ч инкубации при 37 ° C из лунок удаляли 100 мкл среды. 100 мкл реагента люциферазы добавляли в каждую лунку и инкубировали при комнатной температуре в течение 2 минут.100 мкл лизата переносили в 96-луночный черный твердый планшет (Costar), и люминесценцию измеряли с использованием системы анализа репортерного гена люминесценции Bright-Glo (Promega).

Анализы нейтрализации

Активность нейтрализующего антитела

измеряли в 96-луночных культуральных планшетах с использованием экспрессии репортерного гена люциферазы (Luc), регулируемой Tat, для количественной оценки снижения вирусной инфекции в клетках TZM-bl. Клетки TZM-bl были получены из программы исследований и эталонных реагентов NIH AIDS Research and Reference Reagent Program, предоставленной Джоном Каппесом и Сяоюнь Ву.Анализы проводили с вирусами, псевдотипированными Env, как описано ранее [67]. Тестовые образцы разбавляли в диапазоне от 1:20 до 1: 43740 в среде для культивирования клеток и предварительно инкубировали с вирусом (~ 150 000 относительных эквивалентов световых единиц) в течение 1 часа при 37 ° C перед добавлением клеток. После 48-часовой инкубации клетки лизировали и определяли активность Luc с использованием люминометра для микротитровального планшета и реагента BriteLite Plus (Perkin Elmer). Титры нейтрализации — это разведение образца (для сыворотки / плазмы) или концентрация антител (для sCD4, очищенных препаратов IgG и моноклональных антител), при которых относительные единицы люминесценции (RLU) были снижены на 50% по сравнению с RLU в лунках с контролем вируса после вычитания фона RLU в лунках с клеточным контролем.Образцы сыворотки / плазмы инактивировали нагреванием при 56 ° C в течение 1 часа перед анализом. Псевдовирус, созданный с использованием гликопротеина Env из вируса лейкемии мышей (SVA.MLV), использовали в качестве отрицательного контроля [42]. Ответ считался положительным, если ID 50 плазмы против детских T / F вирусов был по крайней мере в 3 раза выше, чем ID 50 псевдовируса SVA.MLV.

Анализ фенотипирования псевдовируса Env

Титры нейтрализации (ID50) определяли по существу, как описано выше, с использованием пяти образцов плазмы от ВИЧ-положительных лиц с хронической инфекцией.Средний геометрический титр (GMT) был рассчитан в Microsoft Excel, а фенотип уровня был определен путем сравнения этих значений с GMT стандартных панелей вирусов, представляющих вирусы уровня 1A, уровня 1B и уровня 2 [42, 68] с использованием тех же пяти ВИЧ + плазмы. образцы.

Алгоритм выбора последовательности

Чтобы выбрать варианты, не передаваемые от матери, и уловить наиболее расходящиеся последовательности из T / F младенца, мы разработали следующий алгоритм. Алгоритм находит наиболее вариабельные положения в аминокислотном выравнивании и ранжирует все последовательности по частотам в этих положениях.Затем выбираются последовательности, начиная с наиболее расходящихся, на основе покрытия мотивов, наблюдаемого при выравнивании и в филогенетическом дереве (другими словами, если все группы расходящихся последовательностей имеют один и тот же мотив, только один в группе и / или узле дерева выбрано).

Статистический анализ

Чтобы проверить, были ли вирусы, передаваемые младенцами, статистически значимо более устойчивыми к материнской плазме, чем непередаваемые материнские последовательности, мы разработали односторонний тест перестановки.На каждой итерации мы случайным образом присваивали статус «передано» любой последовательности в каждой паре младенец-мать, а затем ранжировали оставшиеся последовательности в паре в соответствии с реакциями материнской плазмы. Затем были суммированы все ранги по всем парам. Мы повторили эту рандомизацию 1000 раз, а затем вычислили p-значение как процент от суммы рангов, превышающих наблюдаемую сумму рангов, из всех выполненных рандомизаций. Этот метод является надежным, поскольку он не делает никаких основополагающих предположений о распределении материнской плазмы и сохраняет корреляцию данных между матерью и младенцем.Тот же алгоритм был использован для проверки того, придают ли определенные положения аминокислот устойчивость к материнской плазме и / или антителам. На этот раз «переданным» статусом, который перетасовывался на каждой итерации, была аминокислота дикого типа. Все программирование алгоритма выбора последовательности и проверки перестановки выполнялось на платформе R [69].

Вспомогательная информация

S1 Рис. Филогенетическое дерево и график выделения последовательности

env от пар мать-ребенок с идентификатором образца 100002, 100046, 100155, 100307, ​​100383 и 100504.

Младенческие последовательности помечены красными кружками, а материнские последовательности помечены синими квадратами.

https://doi.org/10.1371/journal.ppat.1006944.s001

(TIF)

S2 Рис. Филогенетическое дерево и график выделения последовательности

env от пар мать-младенец с идентификатором образца 100711, 100890, 101421, 101984, 102149 и 102407.

Последовательности младенцев отмечены красными кружками, а материнские последовательности — синим. квадраты.

https: // doi.org / 10.1371 / journal.ppat.1006944.s002

(TIF)

S3 Рис. Филогенетическое дерево и выделенный график последовательностей из пары мать-младенец 102605.

Младенческие последовательности помечены красным, а материнские последовательности помечены синим. Неслучайное накопление синонимичных мутаций у младенца (которое привело к сбою анализа Пуассона-Фиттера) очевидно справа и отмечено красным прямоугольником.

https://doi.org/10.1371/journal.ppat.1006944.s003

(TIF)

S6 Фиг.Нейтрализационная чувствительность материнских и младенческих псевдовирусов к bNAbs PG9 и Dh529.

IC 50 материнских непередаваемых вариантов (черные точки) и детских T / F вирусов (синие треугольники и кружки) к двум антителам PG9 и Dh529. Черные горизонтальные линии представляют собой медианное значение IC 50 материнских и младенческих последовательностей. Пунктирные линии представляют предел обнаружения.

https://doi.org/10.1371/journal.ppat.1006944.s006

(TIF)

S7 Рис.Анализ нейтрализации сигнатурных аминокислот в области MPER.

(A) Схема области gp41 указывает положение мутировавших аминокислот. (B) Нейтрализационная чувствительность детских T / F вирусов из 100997i и 102407i и их мутантов к парной материнской плазме. ID 50 младенческих вариантов T / F (синие столбцы) и их точечных мутантов (красные столбцы). E662 и K683 являются сайтами сигнатурных последовательностей в области MPER гена оболочки ВИЧ-1. FP = Fusion Peptide, NHR = N-концевой гептадный повтор, CHR = C-концевой гептадный повтор, MPER = Membrane Proximal External Region.

https://doi.org/10.1371/journal.ppat.1006944.s007

(TIF)

Благодарности

Мы благодарим Натана Вандергрифта за выбор образцов перинатальной передачи из когорты WITS. Мы также хотели бы поблагодарить команду педиатрического когортного исследования ВИЧ / СПИДа (PHACS) за их поддержку когортных выборок исследования передачи инфекции у женщин и детей грудного возраста.

Список литературы

  1. 1.
    ЮНЭЙДС. Отчет о ходе реализации Глобального плана: на пути к искоренению новых случаев ВИЧ-инфекции среди детей и сохранению жизни их матерей.ЮНЭЙДС, Женева, Швейцария. 2015.
  2. 2.
    Махи М., Стовер Дж., Кирагу К., Хаяши С., Аквара П., Луо С. и др. Что нужно сделать, чтобы добиться фактического искоренения передачи ВИЧ от матери ребенку? Оценка текущего прогресса и будущих потребностей. Половая трансмиссия. 2010; 86 Приложение 2: ii48–55.
  3. 3.
    Доренбаум А., Каннингем С.К., Гелбер Р.Д., Калнейн М., Мофенсон Л., Бритто П. и др. Две дозы невирапина во время родов / новорожденного и стандартная антиретровирусная терапия для снижения перинатальной передачи ВИЧ: рандомизированное исследование.ДЖАМА. 2002. 288 (2): 189–98. pmid: 12095383
  4. 4.
    Волински С.М., Вик С.М., Корбер Б.Т., Хатто С., Паркс В.П., Розенблюм Л.Л. и др. Избирательная передача вариантов вируса иммунодефицита человека типа 1 от матери младенцу. Наука. 1992; 255 (5048): 1134–7. pmid: 1546316
  5. 5.
    Гарсия П.М., Калиш Л.А., Питт Дж., Минкофф Х., Куинн Т.К., Бурчетт С.К. и др. Уровни РНК вируса иммунодефицита человека 1 типа в плазме крови у матери и риск перинатальной передачи. Группа изучения передачи инфекции у женщин и младенцев.N Engl J Med. 1999. 341 (6): 394–402. pmid: 10432324
  6. 6.
    Кац И.Т., Шапиро Р., Ли Д., Говиндараджулу Ю., Томпсон Б., Уоттс Д.Х. и др. Факторы риска выявления РНК ВИЧ-1 во время родов среди женщин, получающих высокоактивную антиретровирусную терапию, в исследовании передачи инфекции у женщин и младенцев. J Acquir Immune Defic Syndr. 2010. 54 (1): 27–34. pmid: 20065861
  7. 7.
    Магдер Л.С., Мофенсон Л., Пол М.Э., Зоррилла С.Д., Блаттнер В.А., Туомала Р.Э. и др. Факторы риска передачи ВИЧ внутриутробно и во время родов.J Acquir Immune Defic Syndr. 2005. 38 (1): 87–95. pmid: 15608531
  8. 8.
    Bongertz V, Costa CI, Veloso VG, Grinsztejn B, Filho EC, Calvet G и др. Титры нейтрализации и вертикальная передача ВИЧ-1. Scand J Immunol. 2002. 56 (6): 642–4. pmid: 12472677
  9. 9.
    Bongertz V, Costa CI, Veloso VG, Grinsztejn B, Joao Filho EC, Calvet G и др. Вертикальная передача ВИЧ-1: важность нейтрализующего титра и специфичности антител. Scand J Immunol. 2001. 53 (3): 302–9. pmid: 11251889
  10. 10.Скарлатти Дж., Альберт Дж., Росси П., Ходара В., Бираги П., Муджиаска Л. и др. Передача вируса иммунодефицита человека типа 1 от матери ребенку: корреляция с нейтрализующими антителами против первичных изолятов. J Infect Dis. 1993. 168 (1): 207–10. pmid: 8515110
  11. 11.
    Брейбант М., Барин Ф. Роль нейтрализующих антител в предотвращении инфекции ВИЧ-1: чему мы можем научиться из контекста передачи от матери ребенку? Ретровирология. 2013; 10: 103. pmid: 24099103
  12. 12.Блиш К.А., Блей В.М., Хейгвуд Н.Л., Овербоу Дж. Передача ВИЧ-1 в условиях нейтрализующих антител. Curr HIV Res. 2007. 5 (6): 578–87. pmid: 18045114
  13. 13.
    Mutucumarana CP, Eudailey J, McGuire EP, Vandergrift N, Tegha G, Chasela C и др. Материнские гуморальные иммунные корреляты передачи Clade C ВИЧ-1 в период беременности антиретровирусными препаратами. Clin Vaccine Immunol. 2017; 24 (8).
  14. 14.
    Овербо Дж. Передача ВИЧ от матери младенцу: защищают ли материнские антитела к ВИЧ ребенка? PLoS Pathog.2014; 10 (8): e1004283. pmid: 25144453
  15. 15.
    Золла-Пазнер С., Коэн С.С., Бойд Д., Конг ХР, Моряк М., Нуссенцвейг М. и др. Исследования структуры / функций, вовлекающие область V3 оболочки ВИЧ-1, выявляют множественные факторы, влияющие на чувствительность к нейтрализации. J Virol. 2015; 90 (2): 636–49. pmid: 264
  16. 16.
    Ву Х, Параст А.Б., Ричардсон Б.А., Ндуати Р., Джон-Стюарт Г., Мбори-Нгача Д. и др. Варианты ускользания от нейтрализации вируса иммунодефицита человека типа 1 передаются от матери к младенцу.J Virol. 2006. 80 (2): 835–44. pmid: 16378985
  17. 17.
    Fouda GG, Mahlokozera T., Salazar-Gonzalez JF, Salazar MG, Learn G, Kumar SB, et al. Варианты конвертов ВИЧ-1, передаваемые в постнатальном периоде, обладают такой же чувствительностью к нейтрализации и функцией, что и непередаваемые варианты грудного молока. Ретровирология. 2013; 10: 3. pmid: 23305422
  18. 18.
    Рассел Э. С., Квик Дж. Дж., Киз Дж., Бартон К., Мвапаса В., Монтефиори Д. К. и др. Генетическое «узкое место» в вертикальной передаче ВИЧ-1 подтипа C не вызвано отбором особо устойчивого к нейтрализации вируса из материнской вирусной популяции.J Virol. 2011. 85 (16): 8253–62. pmid: 21593171
  19. 19.
    Thenin S, Samleerat T, Tavernier E, Ngo-Giang-Huong N, Jourdain G, Lallemant M и др. Гликопротеины оболочки вариантов вируса иммунодефицита человека типа 1, полученные от пар мать-младенец, обладают широким спектром биологических свойств. Вирусология. 2012. 426 (1): 12–21. pmid: 22310702
  20. 20.
    Bulterys M, Ellington S, Kourtis AP. ВИЧ-1 и грудное вскармливание: биология передачи и достижения в профилактике.Clin Perinatol. 2010; 37 (4): 807–24, ix-x. pmid: 21078452
  21. 21.
    Bulterys PL, Dalai SC, Katzenstein DA. Анализ вирусной последовательности от ВИЧ-инфицированных матерей и младенцев: молекулярная эволюция, разнообразие и факторы риска передачи от матери ребенку. Clin Perinatol. 2010; 37 (4): 739–50, viii. pmid: 21078447
  22. 22.
    Permar SR, Fong Y, Vandergrift N, Fouda GG, Gilbert P, Parks R, et al. Ответные реакции материнских антител, специфичных к оболочке ВИЧ-1, и снижение риска перинатальной передачи.J Clin Invest. 2015; 125 (7): 2702–6. pmid: 26053661
  23. 23.
    Chasela CS, Hudgens MG, Jamieson DJ, Kayira D, Hosseinipour MC, Kourtis AP и др. Антиретровирусные препараты для беременных или младенцев для снижения передачи ВИЧ-1. N Engl J Med. 2010. 362 (24): 2271–81. pmid: 20554982
  24. 24.
    Рич К.К., Фаулер М.Г., Мофенсон Л.М., Аббуд Р., Питт Дж., Диаз С. и др. Материнские и младенческие факторы, предсказывающие прогрессирование заболевания у младенцев, инфицированных вирусом иммунодефицита человека 1 типа. Группа изучения передачи инфекции у женщин и младенцев.Педиатрия. 2000; 105 (1): e8. pmid: 10617745
  25. 25.
    Баалва Дж., Ван С., Пэрриш Н.Ф., Деккер Дж. М., Кил Б.Ф., Learn GH и др. Молекулярная идентификация, клонирование и характеристика передаваемых инфекционных молекулярных клонов ВИЧ-1 подтипа A, D и A / D. Вирусология. 2013. 436 (1): 33–48. pmid: 23123038
  26. 26.
    Кил Б.Ф., Джорджи Е.Е., Салазар-Гонсалес Дж.Ф., Деккер Дж.М., Фам К.Т., Салазар М.Г. и др. Идентификация и характеристика передаваемых и ранних оболочек вируса-основателя при первичной инфекции ВИЧ-1.Proc Natl Acad Sci U S. A. 2008; 105 (21): 7552–7. pmid: 184
  27. 27.
    Накамура К.Дж., Хит Л., Собрера Э.Р., Уилкинсон Т.А., Семрау К., Канкаса С. и др. Грудное молоко и внутриутробная передача ВИЧ-1 выбираются для вариантов оболочки с уникальными молекулярными сигнатурами. Ретровирология. 2017; 14 (1): 6. pmid: 28122636
  28. 28.
    Тобин Н.Х., Альдрованди GM. Иммунология детской ВИЧ-инфекции. Immunol Rev.2013; 254 (1): 143–69. pmid: 23772619
  29. 29.
    Moody MA, Gao F, Gurley TC, Amos JD, Kumar A, Hora B и др.Штамм-специфичные сайты связывания V3 и CD4 Аутологичные нейтрализующие антитела к ВИЧ-1 Выбирают устойчивые к нейтрализации вирусы. Клеточный микроб-хозяин. 2015; 18 (3): 354–62. pmid: 26355218
  30. 30.
    Learn GH, Muthui D, Brodie SJ, Zhu T, Diem K, Mullins JI и др. Гомогенизация вирусной популяции после инфицирования вирусом острого иммунодефицита человека 1 типа. J Virol. 2002. 76 (23): 11953–9. pmid: 12414937
  31. 31.
    Derdeyn CA, Decker JM, Bibollet-Ruche F, Mokili JL, Muldoon M, Denham SA и др.Чувствительный к нейтрализации ВИЧ-1 после гетеросексуальной передачи. Наука. 2004; 303 (5666): 2019–22. pmid: 15044802
  32. 32.
    Zhang LQ, MacKenzie P, Cleland A, Holmes EC, Brown AJ, Simmonds P. Выбор конкретных последовательностей в белке внешней оболочки вируса иммунодефицита человека типа 1 при первичной инфекции. J Virol. 1993. 67 (6): 3345–56. pmid: 8497055
  33. 33.
    Гантт С., Карлссон Дж., Хит Л., Булл М.Э., Шетти А.К., Муцвангва Дж. И др.Генетический анализ последовательностей env ВИЧ-1 демонстрирует ограниченную компартментализацию в грудном молоке и предполагает вирусную репликацию в груди, которая усиливается при мастите. J Virol. 2010. 84 (20): 10812–9. pmid: 20660189
  34. 34.
    Кишко М., Сомасундаран М., Брюстер Ф., Салливан Дж. Л., Клэпхэм П.Р., Лузуриага К. Генотипические и функциональные свойства оболочек ВИЧ-1 раннего младенца. Ретровирология. 2011; 8: 67. pmid: 21843318
  35. 35.
    Хейнс Б.Ф. BT. Широко нейтрализующие антитела и разработка вакцин.ДЖАМА. 2015; 313 (24): 2419–20. pmid: 26103022
  36. 36.
    Klein F, Mouquet H, Dosenovic P, Scheid JF, Scharf L, Nussenzweig MC. Антитела в разработке и терапии вакцины против ВИЧ-1. Наука. 2013; 341 (6151): 1199–204. pmid: 24031012
  37. 37.
    Гаутам Р., Нисимура Ю., Пегу А., Насон М.К., Кляйн Ф., Газумян А. и др. Однократная инъекция антител против ВИЧ-1 защищает от повторных заражений SHIV. Природа. 2016; 533 (7601): 105–9. pmid: 27120156
  38. 38.
    Линч Р.М., Боритц Э., Коутс Э.Э., ДеЗур А., Мэдден П., Костнер П. и др.Вирусологические эффекты введения широко нейтрализующего антитела VRC01 во время хронической ВИЧ-1-инфекции. Sci Transl Med. 2015; 7 (319): 319ra206. pmid: 26702094
  39. 39.
    Воронин Ю., Мофенсон Л.М., Каннингем К.К., Фаулер М.Г., Калебу П., МакФарланд Э.Д. и др. Моноклональные антитела к ВИЧ: новая возможность для дальнейшего снижения передачи ВИЧ от матери ребенку. PLoS Med. 2014; 11 (4): e1001616. pmid: 24714363
  40. 40.
    Ledgerwood JE, Coates EE, Yamshchikov G, Saunders JG, Holman L, Enama ME и др.Безопасность, фармакокинетика и нейтрализация широко нейтрализующего человеческого моноклонального антитела VRC01 к ВИЧ-1 у здоровых взрослых. Clin Exp Immunol. 2015; 182 (3): 289–301. pmid: 26332605
  41. 41.
    Георгий Е.Е., Фанкхаузер Б., Атрея Г., Перельсон А.С., Корбер Б.Т., Бхаттачарья Т. Оценка времени после заражения в ранних однородных образцах ВИЧ-1 с использованием модели Пуассона. BMC Bioinformatics. 2010; 11: 532. pmid: 20973976
  42. 42.
    Моряк М.С., Джейнс Х., Хокинс Н., Грандпре Л.Е., Девой С., Гири А. и др.Многоуровневая категоризация разнообразной панели псевдовирусов Env ВИЧ-1 для оценки нейтрализующих антител. J Virol. 2010. 84 (3): 1439–52. pmid: 19939925
  43. 43.
    Юн Х., Маке Дж., Вест А. П. младший, Фоули Б., Бьоркман П. Дж., Корбер Б. и др. CATNAP: инструмент для составления, анализа и подсчета панелей нейтрализующих антител. Nucleic Acids Res. 2015; 43 (W1): W213–9. pmid: 26044712 ​​
  44. 44.
    Кирчхерр Дж. Л., Лу Х, Касонго В., Чалве В., Мвананьянда Л., Мусонда Р. М. и др. Высокопроизводительный функциональный анализ генов env ВИЧ-1 без клонирования.J Virol Methods. 2007. 143 (1): 104–11. pmid: 17416428
  45. 45.
    Мартинес Д.Р., Вандергрифт Н., Дуглас А.О., Макгуайр Е., Бейнбридж Дж., Найсли Н.И. и др. Материнское связывание и нейтрализующие ответы IgG, нацеленные на С-концевую область петли V3, являются прогностическими факторами снижения риска передачи ВИЧ-1 в послеродовом периоде. J Virol. 2017; 91 (9). pmid: 28202762
  46. 46.
    Fouda GG, Cunningham CK, Permar SR. Вакцины против ВИЧ-1 для младенцев: дополнительные стратегии для снижения передачи вируса от матери ребенку.ДЖАМА. 2015; 313 (15): 1513–4. pmid: 25898044
  47. 47.
    Grobler J, Gray CM, Rademeyer C, Seoighe C, Ramjee G, Karim SA и др. Заболеваемость двойной инфекцией ВИЧ-1 и ее связь с повышенным заданным значением вирусной нагрузки в когорте женщин секс-бизнеса, инфицированных ВИЧ-1 подтипа С. J Infect Dis. 2004. 190 (7): 1355–1355. pmid: 15346349
  48. 48.
    Сагар М., Киркегард Э., Лонг Э.М., Селум С, Бухбиндер С., Даар Э.С. и др. Разнообразие вируса иммунодефицита человека типа 1 (ВИЧ-1) на момент инфицирования не ограничивается определенными группами риска или конкретными подтипами ВИЧ-1.J Virol. 2004. 78 (13): 7279–83. pmid: 15194805
  49. 49.
    Чен Й, Ли Н, Чжан Т., Хуанг Х, Цай Ф, Вандергрифт Н. и др. Комплексная характеристика передаваемых генов / генов-основателей env из одной когорты МСМ в Китае. J Acquir Immune Defic Syndr. 2015; 69 (4): 403–12. pmid: 25886933
  50. 50.
    Ли Х., Бар К.Дж., Ван С., Деккер Дж. М., Чен Ю., Сан С. и др. Высокая множественность инфицирования ВИЧ-1 у мужчин, практикующих секс с мужчинами. PLoS Pathog. 2010; 6 (5): e1000890. pmid: 20485520
  51. 51.Казеннова Е., Лага В., Громов К., Лебедева Н., Жукова Е., Пронин А. и др. Генетические варианты ВИЧ-инфекции 1 типа у МСМ в России. AIDS Res Hum Retroviruses. 2017.
  52. 52.
    Бар К.Дж., Ли Х., Чемберленд А., Тремблей С., Роути Дж. П., Грейсон Т. и др. Широкие различия в множественности инфицирования ВИЧ-1 среди потребителей инъекционных наркотиков. J Virol. 2010. 84 (12): 6241–7. pmid: 20375173
  53. 53.
    Диомид Л., Ниока С., Пастори С., Скотти Л., Замбон А., Шерман Г. и др.Пассивно передаваемые антитела к gp41 у детей, рожденных от ВИЧ-1 подтипа C-серопозитивных женщин: корреляция между тонкой специфичностью и защитой. J Virol. 2012. 86 (8): 4129–38. pmid: 22301151
  54. 54.
    Jiang X, Burke V, Totrov M, Williams C, Cardozo T, Gorny MK и др. Консервативные структурные элементы в короне V3 gp120 ВИЧ-1. Nat Struct Mol Biol. 2010. 17 (8): 955–61. pmid: 20622876
  55. 55.
    Stanfield RL, Gorny MK, Zolla-Pazner S, Wilson IA. Кристаллические структуры нейтрализующего антитела 2219 к вирусу иммунодефицита человека типа 1 (ВИЧ-1) в комплексе с тремя различными пептидами V3 обнаруживают новый способ связывания для перекрестной реактивности ВИЧ-1.J Virol. 2006. 80 (12): 6093–105. pmid: 16731948
  56. 56.
    Лосман Б., Больмштедт А., Шоннинг К., Бьорндал А., Вестин С., Феньо Е.М. и др. Защита нейтрализующих эпитопов в петле V3 олигомерного гликопротеина 120 вируса иммунодефицита человека типа 1 с помощью N-связанных олигосахаридов в области V1. AIDS Res Hum Retroviruses. 2001. 17 (11): 1067–76. pmid: 11485624
  57. 57.
    Уилли Р.Л., Мартин М.А. Ассоциация гликопротеина оболочки вируса иммунодефицита человека типа 1 с частицами зависит от взаимодействий между третьей вариабельной и консервативной областями gp120.J Virol. 1993. 67 (6): 3639–43. pmid: 8497072
  58. 58.
    Люмкис Д., Жюльен Дж. П., де Валь Н., Купо А., Поттер С. С., Класс П. Дж. И др. Крио-ЭМ структура полностью гликозилированного растворимого расщепленного тримера оболочки ВИЧ-1. Наука. 2013; 342 (6165): 1484–90. pmid: 24179160
  59. 59.
    Диковер Р., Гарратти Е., Юсим К., Миллер С., Корбер Б., Брайсон Ю. Роль материнских аутологичных нейтрализующих антител в селективной перинатальной передаче вариантов ускользания вируса иммунодефицита человека типа 1.J Virol. 2006. 80 (13): 6525–33. pmid: 16775339
  60. 60.
    Rainwater SM, Wu X, Nduati R, Nedellec R, Mosier D, John-Stewart G, et al. Клонирование и характеристика функциональных вариантов оболочки ВИЧ-1 подтипа А, передаваемых при грудном вскармливании. Curr HIV Res. 2007. 5 (2): 189–97. pmid: 17346133
  61. 61.
    Миллиган С., Оменда М.М., Чохан В., Одем-Дэвис К., Ричардсон Б.А., Ндуати Р. и др. Варианты материнского устойчивого к нейтрализации вируса не прогнозируют риск инфицирования ВИЧ у младенцев.MBio. 2016; 7 (1): e02221–15. pmid: 26838723
  62. 62.
    Hessell AJ, Jaworski JP, Epson E, Matsuda K, Pandey S, Kahl C и др. Раннее краткосрочное лечение нейтрализующими человеческими моноклональными антителами останавливает инфекцию SHIV у детенышей макак. Nat Med. 2016; 22 (4): 362–8. pmid: 26998834
  63. 63.
    Rudicell RS, Kwon YD, Ko SY, Pegu A, Louder MK, Георгиев И.С. и др. Повышенная эффективность широко нейтрализующего антитела к ВИЧ-1 in vitro улучшает защиту от лентивирусной инфекции in vivo.J Virol. 2014. 88 (21): 12669–82. pmid: 25142607
  64. 64.
    Ким Дж. Х., Скунцу И., Компанс Р., Джейкоб Дж. Оригинальные антигенные ответы на вирусы гриппа. J Immunol. 2009. 183 (5): 3294–301. pmid: 19648276
  65. 65.
    Пак М.С., Ким Джи, Пак С., Ли И., Парк М.С. Исходный антигенный ответ на вирусы РНК и противовирусный иммунитет. Immune Netw. 2016; 16 (5): 261–70. pmid: 27799871
  66. 66.
    Gouy M, Guindon S, Gascuel O. SeaView, версия 4: мультиплатформенный графический пользовательский интерфейс для выравнивания последовательностей и построения филогенетического дерева.Mol Biol Evol. 2010. 27 (2): 221–4. pmid: 19854763
  67. 67.
    Монтефиори, округ Колумбия. Измерение нейтрализации ВИЧ с помощью анализа репортерного гена люциферазы. Методы Мол биол. 2009; 485: 395–405. pmid: 1

    39
  68. 68.
    Ли М., Гао Ф, Маскола Дж. Р., Стамататос Л., Полонис В. Р., Кутсукос М. и др. Клоны env вируса иммунодефицита человека типа 1 от острых и ранних инфекций подтипа B для стандартизированной оценки нейтрализующих антител, вызванных вакциной. J Virol. 2005. 79 (16): 10108–25.pmid: 16051804
  69. 69.
    R DCT. R: Язык и среда для статистических вычислений. R Фонд статистических вычислений, Вена, Австрия. 2008.

(PDF) Дифференциально экспрессируемые поздние компоненты ороговевшей оболочки эпидермиса

Внутри EDC структурно сходные и коэкспрессированные гены LEP

образуют подкластеры. Эта кластеризация может происходить из эволюции

через дупликацию генов или может отражать корегуляцию, т.е.е., там

может быть эпидермальным энхансером на центромерном конце кластера LEP

и или внутренним эпителиальным энхансером на теломерном конце.

Были предложены области контроля локуса в EDC (12, 16).

Возможно, что дифференциальная экспрессия нескольких генов LEP

модулирует качество барьера на поверхности животного, как это было предложено для членов SPRR

. Cabral et al. (9) предположили, что

генов SPRR кодируют структурно гомологичные продукты, которые

различаются, прежде всего, их регуляторными областями.Следовательно, множественные гены

допускают широкий набор регуляторных ответов, что приводит к различиям в эффективных дозах белка

и соответствующем качестве барьера

. Эта повышенная способность модулировать регулирующие ответные реакции

позволила бы тонкие изменения в качестве барьера в ответах на стимулы окружающей среды (9). Подобный аргумент может составлять

для нескольких генов LEP. Однако альтернативная теория, согласно которой специфические особенности белков группы LEP наделяют различные роли

, также возможна, и различие между двумя положениями про

зависит от дальнейших экспериментов.

XP5 и LEP аналогичны известным роговым конвертам, содержащим

составных лорикрину, SPRR, инволюкрину и NICE-1 (12, 13, 15).

N-конец LEP напоминает таковой всех вышеуказанных белков

и содержит остатки глутамина, идентифицированные в лорикрине и

SPRR, как ключевые сайты для активности TGase (26–29). LEP содержат

пролин-лизин-цистеиновых повторов (PKC) в N-концевой половине,

особенность SPRR, за которыми следуют серин-глицин-цистеин-богатые re-

гионов (SGC), характерные для лорикрина.Члены семейства различаются на

и

по количеству повторов PKC и SGC. Крайним примером

является мышиный ген, наиболее похожий на человеческий LEP 18

(1110019L16Rik, таблица 1), который является аномально длинным в результате

сильно увеличенных повторов SGC. Человеческий ген

с этими расширенными повторами отсутствует, что повышает вероятность того, что количество повторов

не имеет особых функциональных последствий.

Первый член этой группы белков, XP5, был обнаружен путем селективного клонирования

из библиотеки кожи с искусственной хромосомой

дрожжей EDC (YAC; исх.12). Zhao и Elder (12) показали, что XP5

экспрессируется в коже, но отсутствует в культивируемых кератиноцитах. NICE-1,

, выделенный из скрининга членов EDC с использованием библиотеки кератиноцитов

, индуцированных кальцием, обнаруживается в культивируемых кератиноцитах, но не в значительной степени в эпидермисе (13), что свидетельствует о том, что культивируемые кератино-

цитов подвергаются воздействию вариантная форма кожной дифференцировки. Однако

структурно NICE-1 далек от группы LEP 兾 XP5.Ни

XP5, ни транскрипты филаггрина не были обнаружены в этом последнем скрининге,

предполагают, что маркеры поздней дифференцировки не были индуцированы в

их библиотеке, что согласуется с нашим выводом о том, что члены LEP 兾 XP5

не обнаруживаются до очень поздних стадий терминальной дифференцировки. из

кальций-индуцированных кератиноцитов. Функция NICE-1 остается неизвестной

; однако он имеет структурное сходство с другими субстратами TGase

, мышиными гомологами и, вероятно, является еще одним новым коррелированным компонентом оболочки (13).

Eig3 — мышиный член группы LEP, обнаруженный с помощью

метода быстрого анализа экспрессии генов для идентификации генов

, активируемых у трансгенных мышей со сверхэкспрессией E2F1 под контролем

базального кератиноцит-специфичного промотора K5 (15). Eig3

сильно экспрессируется во внутреннем эпителии (forestomach), что соответствует

с обнаружением во внутреннем эпителии в этой работе. Wang et al.

(15) сообщают о слабом выражении кожи; однако это может означать перекрестную реакцию

с другими членами семейства, поскольку здесь не обнаруживается кожная экспрессия

.

Во время развития барьерная активность приобретается поэтапно или

стадий (25). Барьерная активность сначала обнаруживается на ст. E16.5 развития мыши

, что определяется как колориметрическими анализами, которые определяют первую стадию образования барьера, так и количественными измерениями трансэпидермальной потери воды (TEWL). Тест TEWL

показывает, что наибольшая барьерная активность достигается на E16.5 (25),

, тогда как исследования с помощью эвапориметра показывают, что барьерная активность

продолжает улучшаться до и после рождения.Низкая молекулярная оценка

поздних изменений во время формирования фетального барьера

. Мы показываем здесь, что экспрессия гена LEP происходит после

экспрессии

других известных ороговевших белков оболочки и очень

близко к первому приобретению барьерной функции плода. Однако белок LEP

обнаруживается только после того, как началось формирование барьера.

Зрелый филаггрин, белок, агрегирующий кератиновые нити, который

формирует матрицу ороговевших клеток или чешуек (30), также

обнаруживается только после образования начального барьера (25).Филаггрин

также является второстепенным компонентом ороговевшей оболочки (31), показывая, что включение белка

в оболочку продолжается после первоначального образования барьера

. Поскольку оба белка появляются поздно во время развития барьера

, интригующая возможность состоит в том, что LEPs играют роль

во взаимодействии оболочка-матрикс во время созревания чешуек.

Работа поддержана Фондом биотехнологий и биологических наук

Research Council Grants 97 兾 A1 兾 G 03357 (D.M.) и S13352 (до

K.N.) и грантом Совета медицинских исследований (Великобритания) G9803920 (до

M.J.H.).

1. Nemes, Z. & Steinert, P. M. (1999a) Exp Mol. Med. 31, 5–19.

2. Steinert, P. M., Marekov, L. N. (1999) Mol. Клетка. Биол. 10, 4247–4261.

3. Кох, П., де Вираг, П., Шарер, Э., Бандман, Д., Лонгли, М., Бикенбах,

Дж., Кавачи, Ю., Суга, Ю., Чжоу, З. ., Хубер М. и др. (2000) J. Cell Biol. 151,

389–400.

4.Джиан П., Исли К. и Грин Х. (2000) J. Cell Biol. 151, 381–388.

5. Робинсон Н. А., Лапич С., Велтер Дж. Ф. и Эккерт Р. Л. (1997) J. Biol. Chem.

272, 12035–12046.

6. Ruhrberg, C. & Watt, F. (1997) Curr. Opin. Genet. Dev. 7, 392–397.

7. Tesfaigzi, J. & Carlson, D. M. (1999) Cell Biochem. Биофиз. 30, 243–265.

8. Картасова, Т., Дарвиче, Н., Коно, Ю., Коидзуми, Х., Осада, С., Хух, Н.,

Личти, У., Стейнерт, П.М. и Куроки Т. (1996) J. Invest. Дерматол. 106, 294–304.

9. Cabral, A., Voskamp, ​​P., Cleton-Jansen, A. M., South, A., Nizetic, D. &

Backendorf, C. (2001) J. Biol. Chem. 276, 19231–19237.

10. Steinert, P. M., Candi, E., Kartasova, T., Marekov, L. (1998) J. Struct. Биол.

122, 76–85.

11. Стейнерт П. М., Картасова Т. и Любен Н. М. (1998) J. Biol. Chem. 19,

11758–11769.

12. Чжао, X. П. и Элдер, Дж.T. (1997) Genomics 45, 250–258.

13. Marenholz, I., Zirra, M., Fisher, D. F., Backendorf, C., Ziegler, A. & Mischke,

,

D. (2001) Genome Res. 11, 341–355.

14. Команда фазы II группы исследований генома RIKEN и консорциум

FANTOM (2001) Nature (Лондон) 409, 685–690.

15. Ван, А., Джонсон, Д. Г., Маклеод, М. С. (2001) Genomics 73, 284–290.

16. Mischke, D. (1998) Subcell. Биохим. 31, 71–104.

17.Маршалл Д., Хардман М. Дж. И Бирн К. (2000) J. Invest. Дерматол. 114,

967–975.

18. Леннон Г. Г., Оффрей К., Полимеропулос М. и Соарес М. Б. (1996)

Геномика 33, 151–152.

19. Ausubel., F.M, Brent, R., Kingston R.E, Moore, D. D., Seidman, J. G., Smith, J. A.

& Struhl, K. (1998) Current Protocols in Molecular Biology (Wiley, New York).

20. Рагхунатх, М., Хеннис, Х. К., Велтен, Ф., Вибе, В., Стейнерт, П.М., Рейс, А.

и Траупе, Х. (1998) Arch. Дерматол. Res. 290, 621–627.

21. Бирн, К., Тайский, М., Фукс, Э. (1994) 120, 2369–2383.

22. Ярник, М., Картасова, Т., Стейнерт, П. М., Лихти, У. и Стивен, А. С. (1996)

J. Cell Sci. 109, 1381–1391.

23. Yuspa, S.H., Kilkenny, A.E., Steinert, P.M., Roop, D.R. (1989) J. Cell Biol.

109, 1207–1217.

24. ДиКоландреа, Т., Карашима, Т., Маатта, А. и Ватт, Ф.М. (2000) J. Cell Biol.

151, 573–586.

25. Хардман М. Дж., Сиси П., Банбери Д. Н. и Бирн К. (1998) Development

(Кембридж, Великобритания) 125, 1541–1552.

26. Deng, J., Pan, R. & Wu, R. (2000) J. Biol. Chem. 275, 5739–5747.

27. Канди, Э., Мелино, Г., Мей, Г., Tarcsa, E., Chung, S.-I, Marekov, L. N. &

, Steinert, P.M. (1995) J. Biol. Chem. 270, 26382–26390.

28. Tarcsa, E., Candi, E., Kartasova, T., Idler, W.W., Marekov, L. N. & Steinert,

P. M. (1998) J. Biol. Chem. 273, 23297–23303.

29. Канди, Э., Тарча, Э., Ледлер, В., Картасова, Т., Мареков, Л. Н., и Штейнерт, П. М.

(1999) J. Biol. Chem. 274, 7226–7237.

30. Дейл Б. А., Ресинг К. А. и Пресланд Р. Б. (1994) в Справочнике по кератиноцитам

, ред. Ли, И. М., Биргитт Лейн, Э. и Ватт, Ф. М. (Кембриджский университет,

,

Press, Кембридж, Великобритания), стр. 323–350.

31.Simon, M., Haftek, M., Sebbag, M., Montezin, M., Girbal-Neuhauser, E.,

Schmitt, D. & Serre, G. (1996) Biochem. J. 317, 173–177.

13036

www.pnas.org 兾 cgi ​​兾 doi 兾 10.1073 兾 pnas.231489198 Marshall et al.

Вомероназальная система новорожденных капибар: морфологическое и иммуногистохимическое исследование

  • 1.

    Кеверне, Э. Б. Феромоны, вомероназальная функция и поведение, зависящее от пола. Ячейка 108 , 735–738 (2002).

    CAS
    PubMed

    Google Scholar

  • 2.

    Келлихер, К. Р. Совместная роль основных обонятельных и вомероназальных систем в социальной коммуникации у млекопитающих. Horm. Behav. 52 , 561–570 (2007).

    PubMed
    PubMed Central

    Google Scholar

  • 3.

    Мейсами Э. и Бхатнагар К. П. Структура и разнообразие добавочной обонятельной луковицы млекопитающих. Microsc. Res. Tech. 43 , 476–499 (1998).

    CAS
    PubMed

    Google Scholar

  • 4.

    Grus, W. E. & Zhang, J. Быстрый оборот и видоспецифичность генов вомероназальных рецепторов феромонов у мышей и крыс. Ген 340 , 303–312 (2004).

    CAS
    PubMed

    Google Scholar

  • 5.

    Martín-Sánchez, A. et al. От сексуального влечения к материнской агрессии: когда феромоны меняют свое поведенческое значение. Horm. Behav. 68 , 65–76 (2015).

    PubMed

    Google Scholar

  • 6.

    Leinders-Zufall, T. et al. Семейство неклассических генов MHC класса I вносит вклад в сверхчувствительную химиодетекцию вомероназальными сенсорными нейронами мыши. J. Neurosci. 34 , 5121–5133 (2014).

    PubMed
    PubMed Central

    Google Scholar

  • 7.

    Папес, Ф., Логан, Д. В. и Стоуэрс, Л. Вомероназальный орган опосредует межвидовое защитное поведение посредством обнаружения гомологов белковых феромонов. Ячейка 141 , 692–703 (2010).

    CAS
    PubMed
    PubMed Central

    Google Scholar

  • 8.

    Bufe, B. et al. Бактериальный пептид MgrB активирует хеморецептор Fpr3 в дополнительной обонятельной системе мыши и стимулирует поведение избегания. Нат. Commun. 10 , 4889 (2019).

    ADS
    PubMed
    PubMed Central

    Google Scholar

  • 9.

    Смит, Дж., Херст, Дж. Л. и Барнард, К. Дж. Сравнение поведения диких и лабораторных линий домашней мыши: уровни сравнения и функциональные выводы. Поведенческий процесс. 32 , 79–86 (1994).

    CAS

    Google Scholar

  • 10.

    Дерриксон, Э. М. Сравнительные репродуктивные стратегии альтрициальных и раннеспелых эвтерианских млекопитающих. Функц. Ecol. 6 , 57–65 (1992).

    Google Scholar

  • 11.

    Шайбер, И. Б. Р., Вайс, Б. М., Кингма, С. А. и Комдер, Дж. Важность альтрициально-раннего спектра для социальной сложности у млекопитающих и птиц — обзор. Фронт. Zool. 14 , 3 (2017).

    PubMed
    PubMed Central

    Google Scholar

  • 12.

    Суарес, Р., Гарсиа-Гонсалес, Д. и де Кастро, Ф. Взаимные различия между основными обонятельными и вомероназальными системами в развитии и эволюции. Фронт. Нейроанат. 6 , 1–14 (2012).

    Google Scholar

  • 13.

    Brunjes, P.C. Созревание обонятельной луковицы у Acomys cahirinus : сходен ли рост нервной системы у прекологических и алтрициальных мюрид? Brain Res. 284 , 335–341 (1983).

    CAS
    PubMed

    Google Scholar

  • 14.

    Леон, М., Куперсмит, Р., Улибарри, К., Портер, Р. Х. и Пауэрс, Дж. Б. Развитие организации обонятельной луковицы у преждевременных и грызунов. Brain Res. 314 , 45–53 (1984).

    CAS
    PubMed

    Google Scholar

  • 15.

    Salazar, I. & Sánchez-Quinteiro, P. Дифференциальное развитие сайтов связывания для четырех лектинов в вомероназальной системе ювенильных мышей: от сайта сенсорной трансдукции до первой стадии ретрансляции. Brain Res. 979 , 15–26 (2003).

    CAS
    PubMed

    Google Scholar

  • 16.

    Оикава Т., Шимамура К., Сайто Т. Р. и Танигучи К. Тонкая структура сошниково-носового органа у шиншиллы ( Chinchilla laniger ). Джиккен Добуцу 43 , 487–497 (1994).

    CAS
    PubMed

    Google Scholar

  • 17.

    Jurcisek, J. A., Durbin, J. E., Kusewitt, D. F., Bakaletz, L.O. Анатомия носовой полости у шиншиллы. Cells Tissues Org. 174 , 136–152 (2003).

    Google Scholar

  • 18.

    Sugai, T., Sugitani, M. & Onoda, N. Подразделения дополнительной обонятельной луковицы морской свинки, выявленные комбинированным методом с иммуногистохимическими, электрофизиологическими и оптическими записями. Неврология 79 , 871–885 (1997).

    CAS
    PubMed

    Google Scholar

  • 19.

    Suárez, R. & Mpodozis, J. Неоднородности размера и полового диморфизма между субдоменами дополнительной обонятельной луковицы, иннервируемой латерально (AOB) Octodon degus (Rodentia: Hystricognathi). Behav. Brain Res. 198 , 306–312 (2009).

    PubMed

    Google Scholar

  • 20.

    Фернандес-Абурто, П., Дельгадо, С. Э., Собреро, Р. и Мподози, Дж. Может ли социальное поведение влиять на асимметрию дополнительных обонятельных луковиц? В качестве примера можно привести родственные виды грызунов-кавиоморф. J. Anat. 236 , 612–621 (2020).

    PubMed

    Google Scholar

  • 21.

    Dennis, J. C. et al. Функционален ли вомероназальный орган землекопа ?. Анат. Рек. 303 , 318–329 (2020).

    Google Scholar

  • 22.

    Броу, Б. М., Вайс, Э. Н. и Парк, Т. Дж. Голые землекопы: слепые, обнаженные и не чувствующие боли. Анат. Рек. 303 , 77–88 (2020).

    CAS

    Google Scholar

  • 23.

    Suárez, R. et al. Общие и дифференциальные признаки дополнительной обонятельной луковицы грызунов-кавиоморфов с особым упором на полуводную капибару. J. Anat. 218 , 558–565 (2011).

    PubMed
    PubMed Central

    Google Scholar

  • 24.

    Салазар И., Сифуэнтес Дж. М. и Санчес-Квинтейро П. Морфологические и иммуногистохимические особенности вомероназальной системы у собак. Анат. Рек. 296 , 146–155 (2013).

    CAS

    Google Scholar

  • 25.

    Салазар, И.& Санчес-Квинтейро, П. Паттерны связывания лектина в сошниково-носовом органе и дополнительной обонятельной луковице крысы. Анат. Эмбриол. 198 , 331–339 (1998).

    CAS
    PubMed

    Google Scholar

  • 26.

    Shapiro, L. S., Ee, P. L. & Halpern, M. Гистохимическая идентификация лектином углеводных фрагментов в хемосенсорных системах опоссума во время развития, с особым акцентом на VVA-идентифицированные подразделения в дополнительной обонятельной луковице. J. Morphol. 224 , 331–349 (1995).

    CAS
    PubMed

    Google Scholar

  • 27.

    Шинохара, Х., Асано, Т. и Като, К. Дифференциальная локализация G-белков Gi и Go в дополнительной обонятельной луковице крысы. J. Neurosci. 12 , 1275–1279 (1992).

    CAS
    PubMed
    PubMed Central

    Google Scholar

  • 28.

    Jia, C. & Halpern, M. Подклассы вомероназальных рецепторных нейронов: дифференциальная экспрессия G-белков (Gi альфа 2 и G (o альфа)) и отдельные выступы на дополнительной обонятельной луковице. Brain Res. 719 , 117–128 (1996).

    CAS
    PubMed

    Google Scholar

  • 29.

    Ортис-Идальго, К. Абелардо Гальего (1879–1930) и его вклад в гистотехнологию: окраски по Гальего. Acta Histochem. 113 , 189–193 (2011).

    PubMed

    Google Scholar

  • 30.

    Толивиа Дж., Толивиа Д. и Наварро А. Новый метод дифференциального окрашивания миелинизированных волокон и нервных клеток на парафиновых срезах. Анат. Рек. 222 , 437–440 (1998).

    Google Scholar

  • 31.

    Салазар И. и Санчес-Квинтейро П. Риск экстраполяции в нейроанатомии: случай вомероназальной системы млекопитающих. Фронт. Нейроанат. 3 , 22 (2009).

    PubMed
    PubMed Central

    Google Scholar

  • 32.

    Д’Оливейра Альбанус, Р., Сикейра Далмолин Р.Дж., Рыбарчик-Филхо, Дж.Л., Алвес Кастро, М.А. и Фонсека Морейра, Дж. К. Дифференциальные эволюционные ограничения в эволюции хеморецепторов: исследование на примере мыши и человека. Sci. Мир J. 23 , 696485 (2014).

  • 33.

    Кеверне, Э.B. Запах здесь, запах там: химическая чувствительность и репродуктивная функция. Нат. Neurosci. 8 , 1637–1638 (2005).

    CAS
    PubMed

    Google Scholar

  • 34.

    Бреннан, П. А. и Зуфалл, Ф. Феромонная коммуникация у позвоночных. Природа 444 , 308–315 (2006).

    ADS
    CAS
    PubMed

    Google Scholar

  • 35.

    Харр, Б. и др. Геномные ресурсы для диких популяций домовой мыши, Mus musculus и его близкого родственника Mus spretus . Sci. Данные 3 , 160075 (2016).

    PubMed
    PubMed Central

    Google Scholar

  • 36.

    Миглино, М. А., Дос Сантос, Т. К., Канаширо, К. и Дос Сантос Ферраз, Р. Х. Морфология и репродуктивная физиология самок капибар. В Капибара: биология, использование и сохранение исключительных неотропических видов (ред. Морейра, Дж. и др. ) 131–146 (Спрингер, Нью-Йорк, 2013).

    Google Scholar

  • 37.

    Salazar, I., Sánchez-Quinteiro, P., Lombardero, M., Alemañ, N., Fernández, P. Внутриутробная зрелость дополнительной обонятельной луковицы у свиней. Chem. Чувства 29 , 3–11 (2004).

    PubMed

    Google Scholar

  • 38.

    Salazar, I., Lombardero, M., Alemañ, N.И Санчес-Квинтейро, П. Развитие вомероназального рецепторного эпителия и дополнительной обонятельной луковицы у овец. Microsc. Res. Tech. 61 , 438–447 (2003).

    PubMed

    Google Scholar

  • 39.

    Salazar, I., Sánchez-Quinteiro, P., Lombardero, M. & Cifuentes, J. M. Гистохимическая идентификация углеводных фрагментов в дополнительной обонятельной луковице мыши с использованием панели лектинов. Chem.Sens. 26 , 645–652 (2001).

    CAS

    Google Scholar

  • 40.

    Кондо Д., Камикава А., Сасаки М. и Китамура Н. Локализация α1-2 фукозного гликана в обонятельном пути мыши. Cells Tissues Org. 203 , 20–28 (2017).

    CAS

    Google Scholar

  • 41.

    Суарес, Р., Фернандес-Абурто, П., Мангер, П. Р. и Мподози, Дж.Ухудшение Gαo вомероназального пути у половодиморфных млекопитающих. PLoS ONE 6 , 10 (2011).

    Google Scholar

  • 42.

    Мальз, К. Р., Кнабе, В. и Кун, Х. Дж. Иммунореактивность кальретинина в пренатально развивающихся обонятельных системах землеройки Tupaia belangeri . Анат. Эмбрион. 205 , 83–97 (2002).

    Google Scholar

  • 43.

    Briñón, J. G. et al. Иммунореактивные элементы к кальретинину, нейрокальцину и парвальбумину в обонятельной луковице ежа ( Erinaceus europaeus ). J. Comput. Neurol. 429 , 554–570 (2001).

    Google Scholar

  • 44.

    Brunjes, P. C., Jazaeri, A. & Sutherland, M. J. Организация и развитие обонятельной луковицы у Monodelphis domestica (серый короткохвостый опоссум). J. Comput. Neurol. 320 , 544–554 (1992).

    CAS

    Google Scholar

  • 45.

    Salazar, I., Sánchez-Quinteiro, P., Cifuentes, J. M. & Fernández, P. Общая организация перинатальной и дополнительной обонятельной луковицы взрослых у мышей. Анат. Рек. 288 , 1009–1025 (2006).

    Google Scholar

  • 46.

    Dehmelt, L. & Halpain, S.Семейство белков, ассоциированных с микротрубочками, MAP2 / Tau. Genome Biol. 6 , 204 (2005).

    PubMed

    Google Scholar

  • 47.

    Schoenfeld, T. A., McKerracher, L., Obar, R. & Vallee, R. B. MAP 1A и MAP 1B представляют собой структурно связанные белки, связанные с микротрубочками, с различными паттернами развития в ЦНС. J. Neurosci. 9 , 1712–1730 (1989).

    CAS
    PubMed
    PubMed Central

    Google Scholar

  • 48.

    Вирек, К., Такер, Р. П. и Матус, А. Обонятельная система взрослых крыс экспрессирует связанные с микротрубочками белки, обнаруженные в развивающемся головном мозге. J. Neurosc. 9 , 3547–3557 (1989).

    CAS

    Google Scholar

  • 49.

    Халперн, М., Шапиро, Л. С. и Джиа, К. Неоднородность дополнительной обонятельной системы. Chem. Чувства 23 , 477–481 (1998).

    CAS
    PubMed

    Google Scholar

  • 50.

    Шапиро, Л. С., Роланд, Р. М. и Халперн, М. Развитие обонятельного маркерного белка и экспрессия N-CAM в хемосенсорных системах опоссума, Monodelphis domestica . J. Morphol. 234 , 109–129 (1997).

    CAS
    PubMed

    Google Scholar

  • 51.

    Villamayor, P. R., Cifuentes, J. M., Fdz-de-Troconiz, P. & Sanchez-Quinteiro, P. Морфологическое и иммуногистохимическое исследование вомероназального органа кролика. J. Anat. 233 , 814–827 (2018).

    CAS
    PubMed

    Google Scholar

  • 52.

    Салазар, И., Санчес-Квинтейро, П. и Сифуэнтес, Дж. М. Компоненты мягких тканей сошниково-носового органа у свиней, коров и лошадей. Анат. Histol. Эмбриол. 26 , 179–186 (1997).

    CAS
    PubMed

    Google Scholar

  • 53.

    Смит, Т.D. et al. Сошниково-носовой орган Lemur catta . Am. J. Primatol. 77 , 229–238 (2015).

    PubMed

    Google Scholar

  • 54.

    Vacarezza, O. L., Sepich, L. N. & Tramezzani, J.H. Вомероназальный орган крысы. J. Anat. 132 , 167–185 (1981).

    Google Scholar

  • 55.

    Rodewald, A., Гисдер, Д., Гебхарт, В. М., Эринг, Х. и Йириковски, Г. Ф. Распределение обонятельного маркерного белка в вомероназальном органе крысы. J. Chem. Нейроанат. 77 , 19–23 (2016).

    CAS
    PubMed

    Google Scholar

  • 56.

    Salazar, I., Sánchez-Quinteiro, P., Cifuentes, J. M., Fernández, P. & Lombardero, M. Распределение артериального кровоснабжения сошниково-носового органа у кошек. Анат. Рек. 247 , 129–136 (1997).

    CAS
    PubMed

    Google Scholar

  • 57.

    Eccles, R. Вегетативная иннервация сошниково-носового органа кошки. Physiol. Behav. 28 , 1011–1015 (1982).

    CAS
    PubMed

    Google Scholar

  • 58.

    Мередит, М., Маркес, Д. М., О’Коннелл, Р. Дж. И Стерн, Ф. Л. Вомероназальный насос: значение для самцов хомяков. Секс. Behav.Sci. 207 , 1224–1226 (1980).

    CAS

    Google Scholar

  • 59.

    Таками, С., Гетчелл, М. Л. и Гетчелл, Т. В. Разрешение сенсорных и слизистых гликоконъюгатов с терминальными остатками альфа-галактозы в мукомикровиллярном комплексе вомероназального сенсорного эпителия с помощью двойной конфокальной лазерной сканирующей микроскопии. Cell Tiss. Res. 280 , 211–216 (1995).

    CAS

    Google Scholar

  • 60.

    Кришна Н. Р., Гетчелл М. Л. и Марголис Ф. Л. Дифференциальная экспрессия вомеромодулина и белка, связывающего одорант, предполагаемых переносчиков феромона и одоранта, в развивающихся хемосенсорных слизистых оболочках носа крысы. J. Neurosci. Res. 40 , 54–71 (1995).

    CAS
    PubMed

    Google Scholar

  • 61.

    Бойсен-Мёллер, Ф. Топография носовых желез крыс и некоторых других млекопитающих. Анат. Рек. 150 , 11–24 (1964).

    PubMed

    Google Scholar

  • 62.

    Cuschieri, A. & Bannister, L.H. Развитие обонятельной слизистой оболочки у мышей: световая микроскопия. J. Anat. 119 , 277 (1975).

    CAS
    PubMed
    PubMed Central

    Google Scholar

  • 63.

    Mendoza, A. S. & Kühnel, W. Морфологические свидетельства прямой иннервации сошниково-носовых желез мышей. Cell Tiss. Res. 247 , 457–459 (1987).

    CAS

    Google Scholar

  • 64.

    Пастор Л. М. и др. Гистохимическое исследование гликоконъюгатов слизистой оболочки носа крысы и морской свинки. Histochem. J. 24 , 727–736 (1992).

    CAS
    PubMed

    Google Scholar

  • 65.

    Kondoh, D. et al. Сравнительные гистологические исследования свойств полисахаридов, секретируемых сошниково-носовыми железами восьми видов Laurasiatheria. Acta Histochem. 122 , 151515 (2020).

    CAS
    PubMed

    Google Scholar

  • 66.

    Рослински Д. Л., Бхатнагар К. П., Берроуз А. М. и Смит Т. Д. Сравнительная морфология и гистохимия желез, связанных с сошниково-носовым органом, у людей, лемуров-мышей и полевок. Анат. Рек. 260 , 92–101 (2000).

    CAS
    PubMed

    Google Scholar

  • 67.

    Танигучи, К. и Мочизуки, К. Морфологические исследования сошниково-носового органа золотого хомяка. Nihon Juigaku Zasshi 44 , 419–426 (1982).

    CAS
    PubMed

    Google Scholar

  • 68.

    Спайсер, С. С., Шульте, Б. А. и Томопулос, Г. Н. Гистохимические свойства эпителия дыхательных путей у разных видов. Am. Преподобный Респир. Дис. 128 , S20 – S26 (1983).

    CAS
    PubMed

    Google Scholar

  • 69.

    Takami, S., Getchell, M. L. & Getchell, T. V. Гистохимическая локализация лектина галактозы, N-ацетилгалактозамина и N-ацетилглюкозамина в гликоконъюгатах вомероназального органа крысы по сравнению со слизистой оболочкой обоняния и перегородки. Cell Tiss. Res. 277 , 211–230 (1994).

    CAS

    Google Scholar

  • 70.

    Park, J. et al. Изменения развития, влияющие на связывание лектина в сошниково-носовом органе домашних свиней, Sus scrofa . Acta Histochem. 114 , 24–30 (2012).

    CAS
    PubMed

    Google Scholar

  • 71.

    Schwanzel-Fukuda, M. & Pfaff, D. W. Происхождение нейронов высвобождающего лютеинизирующий гормон гормона. Nature 338 , 161–164 (1989).

    ADS
    CAS
    PubMed

    Google Scholar

  • 72.

    Villamayor, P. R., Cifuentes, J. M., Quintela, L., Barcia, R. & Sánchez-Quinteiro, P. Структурное, морфометрическое и иммуногистохимическое исследование дополнительной обонятельной луковицы кролика. Brain Struct. Функц. 225 , 203–226 (2020).

    PubMed

    Google Scholar

  • 73.

    Jia, C. & Halpern, M. Calbindin D28k, парвальбумин и кальретинин иммунореактивность в основных и дополнительных обонятельных луковицах серого короткохвостого опоссума, Monodelphis domestica . J. Morphol. 259 , 271–280 (2004).

    PubMed

    Google Scholar

  • 74.

    Skeen, L.C. и Hall, W.C. Эфферентные проекции основной и дополнительной обонятельной луковицы у землеройки ( Tupaia glis ). J. Comput. Neurol. 172 , 1–35 (1977).

    CAS

    Google Scholar

  • 75.

    McCotter, R.E. Соединение сошниково-носовых нервов с дополнительной обонятельной луковицей у опоссума и других млекопитающих.

  • Добавить комментарий

    Ваш адрес email не будет опубликован. Обязательные поля помечены *